The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function.
Codondex
Intron k-mers and protein signatures identify cells for precisely targeted patient immunity
Tuesday, October 29, 2024
Pathogens And Immunity - Mutual Memories
The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function.
Sunday, October 27, 2024
Keep Your TP53 Cool!
Ancestral functions of p53 operate through conserved mechanisms to contain DNA retrotransposons, which are large genomic regions containing repeat sequences. L1 are a class of transposable DNA elements found in 17% of the genome that are evolutionarily associated with primitive viral origins. Around 100 have retained the ability to retro-transpose. Findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility.
HSATII and intact L1 are under selection to maintain CpG motifs, and specific Alu repeat families likewise maintain the proximal presence of inverted repeats to form double-stranded RNA (dsRNA). This demonstrated that viral mimicry is a general evolutionary mechanism whereby genomes co-opt pathogen-associated features, generated by prone repetitive sequences, likely offering an advantage as a quality control system against transcriptional dysregulation. For multicellular organisms with a high degree of epigenetic regulation, a repeat species with a non-immune function may be co-opted, maintaining stimulatory features that release a danger signal when epigenetic control is lost, such as during the release of repeats after p53 mutations, where immunostimulatory repeats may provide a back-up for p53 functions such as senescence.
Further, torsional flexibility of DNA at certain p53 response elements (RE's) is a significant factor that stages early to late binding of p53 to RE's and has been shown to determine the order and outcome of gene signaling in response to stress and other cellular conditions. This staging prioritizes the initial steps of p53-dependent target-gene expressions, thereby contributing to survival versus death decisions in the p53 system. The mechanism of joint regulation through half-sites is also relevant to transcription and expands the number of genes that may be directly controlled in master regulatory networks.
This was demonstrated through the flexibility of ~200 p53 REs and functional outcomes of p53-target gene activations. Genes belonging to pathways that were activated rapidly upon stress contain p53 REs that have significantly more torsional flexibility relative to p53 REs of genes involved in pathways that are activated later in the response to stress.
RE binding can also be impacted by way of the following example. A single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor gene (FLT1) generates a half-site p53 response element (RE) that results in p53 responsiveness of the promoter. Transcriptional regulation required an Estrogen Receptor half site response element (ERE) 225 nucleotides upstream.
RE regulation is also evident in the GCGTG core AhR RE invoked by Dioxin. From 48 sequenced samples of two different tumors, Codondex identified 9 unique Key Sequences (KS) of the TP53 Consensus that contained the core AhR 5′-GCGTG-3′ binding sequence, including some that overlapped p53 RE quarter binding sites (underlined) as illustrated below;
(TP53 intron1) GGATAGGAGTTCCAGACCAGCGTGGCCA TP53 [1706,1710], AhR [1699,1726]
(TP53 intron1) AAAAATTAGCTGGGCGTGGTGGGTGCCT AhR [1760,1787], TP53 [1783,1787]
Subject to the torsional staging at p53 RE's the implication is that nuclear relocation of AhR, by dioxins, to bind AhR RE's may also influence TP53 transcription especially at overlapping or proximal p53 RE's. p53 binding the TP53 promoter can also invoke an autoregulation that, in addition to torsional flexibility, is also sensitive to dosage and autoregulation at the TP53 P2 internal promoter.
Under normal conditions TP53 is infrequently translated and p53 levels remain in steady state, but Under certain epigenetic conditions auto and other forms of p53 regulation begin to impact its massive regulatory network widely affecting cellular function. p53 can also autoregulate transcription while Tp53 is being transcribed. In these situations TP53 could open to p53 binding because of the active cycle of p53 translation (subject to its degradation and with positive nucleation signals) at particular RE's.
These conserved mechanisms to restrain retrotransposons and order p53's binding priority at RE's provide insight to the refined nature of gene stability and transcription. However, gene transcription is often imperfect in co-operation or competition with other nearby genes and proteins that affect predicted outcomes.
Monday, March 4, 2024
p53 Direct Mechanisms In Immunity
Never in the field of molecular oncology have so many sites of posttranslational modification in one protein (p53) been modified by so many different enzymes, but direct response mechanisms that increase immune receptors are rarely discovered and have important implications.
In the tumor microenvironment (TME), cancer associated fibroblasts (CAFs) display an activated phenotype and can physically remodel the extracellular matrix (ECM). Silencing p53 in the CAFs strongly compromised this activity, implicating p53 as a key contributor to a distinctive CAF feature. Here, the non-autonomous, tumor-suppressive activity of non-mutant p53 cDNA is rewired to become a significant contributor to the CAFs’ tumor-supportive activities. This surprising role for p53 in CAFs suggests that, during tumor progression p53 functionality is altered, not only in the cancer cells, but also in their adjacent stroma.
Although p53 is not mutated in the human placenta, it has become functionally incompetent. Why and how p53 is functionally incompetent in cytotrophoblast cells might well be the key to understanding trophoblast invasion. Vascular remodeling for placentation is controlled by small populations of conventional Natural Killer cells, distinct from much larger populations of uterine NK cells, that acidify the ECM with a2V-ATPase, that activates MMP9, degrades the ECM and releases stored pro-angiogenesis growth factors. Similarly hypoxic TME's that in NK cells sustain excessive mitochondrial fission resulting in fragmentation could cause a2V-ATP activated MMP9 to similarly degrade ECM and promote angiogenesis in the early TME.
Another MMP protein, MMP2 is a ligand for the Toll-like receptor 2 (Tlr2). Expression of Tlr2 and Tlr4 in the TME is important for the promotion of tumor growth, and when both of these receptors are absent, growth is compromised. Furthermore, the expression of Tlr2 and Tlr4 in both hematopoietic and stromal compartments appears to support MMP2-driven tumor growth.
The integration of the TLR gene family into the p53 regulatory network is unique to primates. p53 promoter response elements that are targeted by this DNA damage and stress-responsive regulator suggest a general p53 role in the control of human TLR gene expression. TLR genes show responses to DNA damage, and most are p53-mediated. TLR's mediate innate immunity to a wide variety of threats through recognition of conserved pathogen-associated molecular motifs. Expression of all TLR genes, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors with considerable inter-individual variability. Most TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites.
A polymorphism in a TLR8 response element provided the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings—demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress—have many implications for health and disease, as well as for understanding the evolution of DNA damage and p53 responsive networks. That p53 can directly increase an inflammatory response differs from the generally held view relating to the antagonistic affect of p53 on inflammation directed by NF-κB. However, the direct mechanism here is different in that it involves another p53-mediated increase in a receptor that translates ligand interactions into cytokine responses.
Wednesday, February 28, 2024
p53 Convergence and Immunity
Renewed interest in Bradykinin and its inactivation, by Angiotensin Converting Enzyme (ACE), during Covid infection reconfirmed RAS and KKS (Kallikrein-Kinin, Bradykinin) as the major systems of vasodilation and constriction contributing to blood pressure and disease. ACE2, a molecule of focus in Covid, reduces the Bradykinin product des-Arg9 bradykinin to inactive metabolites.
In uterine immune cells RAS proteins AT1, AT2, and ANP are expressed and ANP co-localizes to uterine Natural Killer (uNK) cells between pregnancy day 10 and 12, immediately before spiral arterial modification. In mice this suggested that uNK contributes to the physiological changes in blood pressure between days 5 and 12.
During the first trimester the uNK cells dramatically increase, from around 15% to 70% of immune cells in the Decidua of the Uterus. Expressed RAS-KKS proteins during this time may be solely responsible for amplified stimulation of the plasma contact system at least via p53-mediated transcription and activation of the BK2 promoter.
In myocytes stretch-mediated release of angiotensin II (AngII) induced apoptosis by activating p53 that enhanced local RAS and decreased the Bcl-2-to-Bax protein ratio in the cell. In endothelial cells mechanical stretch interconnected innate and adaptive immune response in hypertension. This suggests that mechanical forces, such as those experienced in hypertension, can influence the immune system and contribute to inflammation, vascular damage associated with high blood pressure and vascular remodeling.
It adds up that the massively disproportionate uNK activity in pregnancy and its impact on the mechanics of blood pressure could amplify sensitivities for p53 mediated stress response. It’s known that uNK cells contribute to the remodeling of spiral arteries and regulation of blood pressure, which are critical for fetal development. Similarly, on a cellular scale, abnormal cell growth and expansion of NK cells, may also amplify conditions that direct NK education and licensing to support growth, as in solid tumors and micro-vascular remodeling, or trigger inflammation, through cytokine expression and/or granulocyte killing of expanded missing-self cells.
Sunday, January 28, 2024
All Roads Lead to (Ch)Romosome 19!
A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.
Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.
Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose.
Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis.
The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure.
Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.
Monday, January 1, 2024
p53 - Mediator Of Natural Killer Education
uNK are closely associated with spiral artery remodeling, for placentation at the blastocyst implantation site. They possess a functional Renin- Angiotensin system (RAS), the cornerstones of blood pressure. The ratio of uNK cells expressing Angiotensin II receptor type 1 (AT1) markedly changed between gestation day 6 and 10. At day 10-12 Atrial Natriuretic Peptide, for vasoconstriction and dilation, strongly co-localized to uNK cells at the implantation sites. Expression of these vasoregulatory molecules by uNK suggests they contribute to the changes in blood pressure that occur between days 5 and 12 coincidental with their population explosion in the decidua during normal pregnancy.
Similar to Angiotensin, Bradykinin (BK) is produced from an inactive pre-protein kininogen that is activated by serine protease kallikrein (KLK), mostly represented on chromosome 19, where they associate with a number of other genes involved in blood pressure. Oakridge scientists predicted that BK induced a Covid19 "cytokine storm" that is responsible for disease progression.
KLK's are located at 19q13.41, an active transposon region with a 2x background deletion rate clustered near Zinc Fingers and KIR's (Killer immunoglobulin like receptors) that inhibit NK cells. A link was confirmed in mice uterine NK cells that regulated local tissue blood pressure, by at least AT1, partly in response to mechanical stretch of vasoconstriction and dilation induced by uterine NK's internal RAS.
In reproduction, at Chromosome 19 MiRNA Cluster (C19MC), 59 known miRNAs are highly expressed in human placentas and in the serum of pregnant women. Numerous C19MC miRNA's are also found in peripheral blood NK's and at least miR-517a-3p (a C19MC from fetal placenta) was incorporated into maternal NK cells in the third trimester, and was rapidly cleared after delivery. miRNA's also regulate the migration of human trophoblasts and suppress epithelial to mesenchymal transition (EMT) genes that are critical for maintaining the epithelial cytotrophoblast stem cell phenotype.
In hepatocellular carcinoma (HCC) a co-regulatory network exists between C19MC miRNAs, melanoma-A antigens (MAGEAs), IFN-γ and p53 that promotes an oncogenic role of C19MC and is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 plays an antagonistic role. Its an important immunoregulartory network, because, in the very least, IFN-γ and IL6 have a major baring on the expression of HLA/MHC molecules on cancer cells.
Immediately adjacent to C19MC, is the leukocyte immunoglobulin-like receptor complex, from where LILRB1 receptor, also known as Mir-7, is expressed on NK cells. It binds MHC class I molecules, on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. LILRB1 has a polymorphic regulatory region that enhances transcription in NK Cells and recruits zinc finger protein YY1 that inhibits p53. It is required to educate expanded human NK cells and defines a unique antitumor NK cell subset with potent antibody-dependent cellular cytotoxicity.
In 2019 a study of arsenite-induced, human keratinocyte transformation demonstrated that knockdown of m6A methyltransferase (METTL3) significantly decreased m6A level, restored p53 activation and inhibited phenotypes in the-transformed cells. m6A downregulated expression of positive p53 regulator, PRDM2, through YTHDF2-promoted decay of mRNAs. m6A also upregulated expression of negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. Taken together, the study revealed the novel role of m6A in mediating human keratinocyte transformation by suppressing p53 activation and sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.
In 2021 a discovery that YTHDF2 is upregulated in NK cells upon activation by cytokines, tumors, and cytomegalovirus infection. YTHDF2 maintains NK cell homeostasis and terminal maturation. It promotes NK cell effector function and is required for IL-15-mediated NK cell survival and proliferation by forming a STAT5-YTHDF2 positive feedback loop. Analysis showed significant enrichment in cell cycle, division, including mitotic cytokinesis, chromosome segregation, spindle, nucleosome, midbody, and chromosome. This data supports roles of YTHDF2 in regulating NK proliferation, survival, and effector functions.
As part of the 2021 discovery, transcriptome-wide screening identified TDP-43 to be involved in cell proliferation or survival as a YTHDF2-binding target in NK cells. TDP-43 induces p53-mediated cell death of cortical progenitors and immature neurons. Growth of the developing cerebral cortex is controlled by Mir-7 through the p53 Pathway
Here we have broadly described mechanisms by which NK cells maintain tissue homeostasis where tightly regulated p53 optimizes cellular conditions to 'self' educate the expanded NK cells. Those that express NKG2A and/or one or several KIRs, for which cognate ligands are present, become educated and as such transform to potent killers in response to their missing-self. Therefore, p53 isoforms have the innate capacity to promote a cellular homeostasis that makes it the mediator for optimal education of expanded NK cells.
Tuesday, October 10, 2023
Cancer's HLA-G Backdoor
piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.
Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.
A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.
HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.
Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME.
Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.