Pathogens And Immunity - Mutual Memories

The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 

p53 Direct Mechanisms In Immunity

Never in the field of molecular oncology have so many sites of posttranslational modification in one protein (p53) been modified by so many different enzymes, but direct response mechanisms that increase immune receptors are rarely discovered and have important implications.  

In the tumor microenvironment (TME), cancer associated fibroblasts (CAFs) display an activated phenotype and can physically remodel the extracellular matrix (ECM). Silencing p53 in the CAFs strongly compromised this activity, implicating p53 as a key contributor to a distinctive CAF feature. Here, the non-autonomous, tumor-suppressive activity of non-mutant p53 cDNA is rewired to become a significant contributor to the CAFs’ tumor-supportive activities. This surprising role for p53 in CAFs suggests that, during tumor progression p53 functionality is altered, not only in the cancer cells, but also in their adjacent stroma.

Although p53 is not mutated in the human placenta, it has become functionally incompetent. Why and how p53 is functionally incompetent in cytotrophoblast cells might well be the key to understanding trophoblast invasion. Vascular remodeling for placentation is controlled by small populations of conventional Natural Killer cells, distinct from much larger populations of uterine NK cells, that acidify the ECM with a2V-ATPase, that activates MMP9, degrades the ECM and releases stored pro-angiogenesis growth factors. Similarly hypoxic TME's that in NK cells sustain excessive mitochondrial fission resulting in fragmentation could cause a2V-ATP activated MMP9 to similarly degrade ECM and promote angiogenesis in the early TME.  

Another MMP protein, MMP2 is a ligand for the Toll-like receptor 2 (Tlr2). Expression of Tlr2 and Tlr4 in the TME is important for the promotion of tumor growth, and when both of these receptors are absent, growth is compromised. Furthermore, the expression of Tlr2 and Tlr4 in both hematopoietic and stromal compartments appears to support MMP2-driven tumor growth.

The integration of the TLR gene family into the p53 regulatory network is unique to primates. p53 promoter response elements that are targeted by this DNA damage and stress-responsive regulator suggest a general p53 role in the control of human TLR gene expression. TLR genes show responses to DNA damage, and most are p53-mediated. TLR's mediate innate immunity to a wide variety of threats through recognition of conserved pathogen-associated molecular motifs. Expression of all TLR genes, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors with considerable inter-individual variability. Most TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites.

A polymorphism in a TLR8 response element provided the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings—demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress—have many implications for health and disease, as well as for understanding the evolution of DNA damage and p53 responsive networks. That p53 can directly increase an inflammatory response differs from the generally held view relating to the antagonistic affect of p53 on inflammation directed by NF-κB. However, the direct mechanism here is different in that it involves another p53-mediated increase in a receptor that translates ligand interactions into cytokine responses.

All Roads Lead to (Ch)Romosome 19!

A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

A pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure. 

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

Cancer's HLA-G Backdoor

piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.

When Immunity Fails Programmed Cell Death

DNA Damage Response

Telomeric repeat (TR) sequences are responsible for genome integrity, where instability is a primary factor that leads to activation of p53. Introduction of a TR into cells leads to stabilization of p53, specific to TRs and not observed in plasmids containing non-TR sequences. TR-activated p53 exhibited enhanced transcriptional activity and induced p53-dependent growth suppression, measured as a reduction in colony formation. Sub-telomeric p53 binding prevents accumulation of DNA damage at human telomeres.  

Healthy cells experience thousands of DNA lesions per day. Micronuclei, containing broken fragments of DNA or chromosomes, that have become isolated, are recognized as one mediator of DNA damage response (DDR)-associated immune recognition. Like micronuclear DNA, mitochondrial DNA (mtDNA) is recognized by cGAS to drive STING-mediated inflammatory signaling. Mitochondrial damage can intersect DNA repair and inflammatory cascades with programmed cell death, through p53. In human fibroblasts and conditionally immortalized vascular smooth muscle cells p53 mediates CD54 (ICAM-1) overexpression in senescence.

Replicative senescence, an autophagy dependent program and crisis are anti-proliferative barriers that human cells must evade to gain immortality. Telomere-to-mitochondria signaling by ZBP1 mediates replicative crisis. Dysfunctional telomeres activate innate immune responses (IFN) through mitochondrial TR RNA (TERRA)–ZBP1 complexes. Senescence occurs when shortened telomeres elicit a p53 and RB dependent DNA-damage response. A crisis-associated isoform of ZBP1(innate immune sensor) is induced by the cGAS–STING DNA-sensing pathway, but reaches full activation only when associated with TERRA transcripts from dysfunctional telomeres. p53 utilizes the cGAS/STING innate immune system pathway for both cell intrinsic and cell extrinsic tumor suppressor activities. cGAS-STING activation induces the production of IFN-b and increases CD54 expression in  human cerebral microvascular endothelial cells.

In melanoma patients there is a significant correlation between cGAS expression levels and survival and between NK cell receptor expression levels and survival. Loss of cGAS expression by tumor cells could permit the tumor cell to circumvent senescence or prevent immunostimulatory NKG2D ligands expression. Loss of p53 and gain of oncogenic RAS exacerbated pro-malignant paracrine signaling activities of senescence-associated secretory phenotypes. Results imply that heterogeneity in cGAS activity, across tumors, could be an important predictor of cancer prognosis and response to treatment and suggest that NK cells could play an important role in mediating anti-tumor effects. Coculture of wild-type p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. 

When p53 consensus sequences are modified and DNA damage response is compromised, replicative crisis ensues, mitochondrial membranes misfunction, mtDNA expression is downregulated and IFN signaling upregulates. A cell may then express activating immune ligands that bind NK receptors signaling non-self and cytolytic death or inhibitory receptors that signal self and immortality. 

Indispensable Mitochondria - Cancers back door?

Immediately prior to fertilization spermatozoa are devoid of Mitochondrial DNA (mtDNA), potentially explaining an aspect about selection that may serve the legacy for maternal immune tolerance. Post fertilization, on day 11-13, outermost trophoblasts of the blastocyst dock with the decidual lining as it embeds in the uterine wall. Then, maternal vascular remodeling and placental formation begin toward successful implantation. 

Higher quality trophoblasts are associated with lower mtDNA content. Moreover, euploid blastocysts with higher mtDNA content had a lower chance to implant and mtDNA replication is strictly downregulated between fertilization and the implantation. What is it about absent or reduced mtDNA that may also relate to the mechanics of immune tolerance and vascular remodeling, which are also features of solid tumors.

The initial absence or downregulation of MtDNA, may relate an immune tolerance by uterine Natural Killer (NK) cells. As mtDNA upregulates, after day 12, it may initiate NK auto-reactivity required for maternal microvascular remodeling. This auto-immune paradox is a prerequisite for vascular remodeling, which is also seen in localized hypertension, and the likely basis of successful blastocyst implantation. Acutely, micro-hypertension induced mechanical stretch, on endothelial cells, interconnects innate and adaptive immune responses. 

The dominant cell in the decidua is an NK subset (dNK), they express low levels of IFN-γ and express proteins of Renin Angiotensin System (RAS). At day 12 RAS peptide ANP colocalizes to dNK’s suggesting that dNK RAS infers localized responsiveness.  When TFAM, required for transcription of mtDNA, was deleted from cardiomyocytes, after 32 days, animals developed cardiomyopathy and Nppa (gene encoding ANP) and Nppb expression was elevated. 

In monocytes increased endothelial stretch activates STAT3, which is involved in driving almost all pathways that control NK cytolytic activity and reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis. p53, Stat3, and, potentially, the estrogen receptor are thought to act as co-regulators, affecting mitochondrial gene expression through protein-protein interactions. Co-immunoprecipitation of p53 with TFAM suggests it may regulate mitochondrial DNA-damage repair.

Like initial trophoblasts with low level mtDNA, mature cells, like cardiomyocytes that prolong low level mtDNA may also aggravate autoimmune sponsored hypertension that remodels microvascular networks providing nutrients for growth of reduced mtDNA stem cell replicas. Indeed, mitochondrial dysfunction (from depleted mtDNA) does not affect pluripotent gene expression, but results in severe defects in lineage differentiation.

During severe sepsis, intense, on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. This may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. 

Identifying cells that optimally educate cocultured NK cells for precision IFN-γ and cytolytic responsiveness is part of the ongoing work by the Codondex team.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Tolerating Your Non-self!

Immune cells get comfortable with cancer
Courtesy https://deepai.org

A hallmark of cancer, autoimmunity and disease is the aberrant transcription of typically silenced, repetitive genetic elements that mimic Pathogen-Associated Molecular Patterns (PAMP's) that bind Pattern Recognition Receptors (PPR's) triggering the innate immune system and inflammation. Unrestrained, this 'viral mimicry' activates a generally conserved mechanism that, under restraint, supports homeostasis. These repetitive viral DNA sequences normally act as a quality control over genomic dysregulation responding in ways that preferentially promote immune conditions for stability. If aberrantly unrestrained and the 'viral mimicry' is transcribed it may result in undesirable immune reactions that disrupt the homeostasis of cells.

Mitochondrial DNA (mtDNA) are one source of cytosolic double stranded RNA (dsRNA) that is commonly present in cells. Trp53 Mutant Embryonic Fibroblasts (MEF's) contain innate immune stimulating endogenous dsRNA, from mtDNA that mimic PAMP's. The immune response, via RIG-1 like PRR, leads to expression of type 1 interferon (IFN) and proinflammatory cytokine genes. Further, Natural Killer cells also produce a multitude of cytokines that can promote or dampen an immune response. Wild-type p53 suppresses viral repeats and contributes to innate immunity by enhancing IFN-dependent antiviral activity independent of its function as a proapoptotic and tumor suppressor gene. 

Post-translationally modified P53, located in the cytoplasm, enhances the permeability of the mitochondrial outer membrane thus stimulating apoptosis. However, treating Trp53 mutant MEF's with DNA demethylating agent caused a huge increase in the level of transcripts encoding short interspersed nuclear elements and other species of noncoding RNAs that generated a strong type 1 IFN response. This did not occur in p53 wild-type MEF's. Thus it appears that another function of p53 is to silence repeats that can accidentally induce an immune response.

This has several implications for how we understand self versus non-self discrimination. When pathogen-associated features were quantified, specific repeats in the genome not only display PAMP's capable of stimulating PRRs but, in some instances, have seemingly maintained such features under selection. For organisms with a high degree of epigenetic regulation and chromosomal organization immuno-stimulatory repeats release a danger signal, such as repeats released after p53 mutations. Here, immune stimulation may act as back-up for the failure of other p53 functions such as apoptosis or senescence due to mutation. This supports the hypothesis that specific repeats gained favor by maintaining non-self PAMPs to act as sensors for loss of heterochromatin as an epigenetic checkpoint of quality control that avoids genome instability generally. 

When P53 mutates it begins to fail its restraint of viral suppression, this enables a 'viral mimicry' and aberrant immune reactions. These may promote survival of cells that can leverage immunity, promote angiogenesis and heightened proliferation of cancers, or other diseases under modified conditions for non-self tolerance. 

ΔΨm and Immune Responses to Disease

Each cell contains hundreds to thousands of mitochondria, each with hundreds of electron transport chain complexes (ETC) that deliver ATP as the cells primary energy source and the central dogma of eukaryote existence. ETC function's, on the inner mitochondrial membrane, are sensitive to change in electric charge represented as mitochondrial polarization and mitochondrial membrane potential (ΔΨm). The large responsive surface area of the outer and inner membrane promotes remodeling and protein interactions that may lead to cellular diseases including cancer.

Tumor Necrosis Factor (TNF) causes mitochondria to relocate, to bind the nucleus and efficiently shuttle elements that enable fast DNA transcription and signaling that, under certain conditions, may suppress the pro inflammatory immune response. TNF signaling to mitochondrial PINK1 stabilizes ubiquitin chains that result in mitochondrial relocation and shuttling activated p65 that increases NF-κB transcription in the nucleus. This anti-apoptotic response resembles the feed forward activation loop in Pink1/Parkin-dependent mitophagy as an independent defense against accumulation of dysfunctional mitochondria, that under physiological conditions integrate their roles in innate immune signaling and stress. 

Enhanced activation of NF-κB by TNF, via mutant p53, concomitantly suppressed the pro-apoptotic effect of TNF leading to increased invasiveness of cancer cells. Accordingly mutant p53 may directly affect nuclear accumulation and retention of p65 upon cytokine exposure as mutant p53 overexpression and nuclear p65 staining in tumors strongly correlated.

Stresses elicited by aneuploid states in cells mediate interaction between Natural Killer (NK) cells. In highly aneuploid cancer cell lines NF-κB signaling is upregulated and activated promoting immune clearance by NK cells, but anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Rapid NF-κB signaling may be preferentially selected because it antagonizes p53, known to inhibit the growth of highly aneuploid cells. Significantly increased mitochondrial DNA in aneuploid cells may result from increased fission of mitochondria, similar to that found in extreme ploidy during Oocyte development. Perhaps supporting the reason in embryonic stem cells (ESC) apoptosis occurs independent of p53 and protein kinase Akt3, the regulator of ESC apoptosis, suppresses p53 for the survival and proliferation of these stem cells.

A comprehensive metabolic analysis identified mitochondrial polarization as a gatekeeper of NK cell priming, activation, and function. Mitochondrial fusion and OXPHOS promote long-term persistence and improve cytokine production by NK cells. Hypoxic Tumor Micro Environments (TME) sustained NK cell activation of mTOR-Drp1, which resulted in excessive mitochondrial fission and fragmentation. Inhibition of fragmentation improved mitochondrial metabolism, survival and the antitumor capacity of NK cells. 

Mitochondrial biogenesis also requires the initiation of Drp1-driven fission. Whereas, fissions from dysfunction are associated with diminished ΔΨm and Reactive Oxygen Species (ROS), which are unchanged in this biogenesis. Depletion of p53 exaggerates fragmentation, but does not affect ΔΨm and ROS levels. Instead, p53 depletion activates mTORC1/4EBP1 signaling that regulates MTFP1 protein expression to govern Drp1-mediated fission. Thus, increased fission upon p53 loss can stimulate biogenesis, but not accumulation of damaged mitochondria. This may explain how mitochondrial integrity, in context of p53 deficiency induced fragmentation, may suppress immune signaling.

Downregulating p53 expression or elevating the molecular signature of mitochondrial fission correlates with aggressive tumor phenotypes and poor prognosis in cancer patients. Upon p53 loss, exaggerated fragmentation stimulates the activation of ERK1/2 signaling resulting in epithelial-to-mesenchymal transition-like changes in cell morphology, accompanied by accelerated MMP9 expression and invasive cell migration. Notably, blocking the activation of mTORC1/MTFP1/Drp1/ERK1/2 axis completely abolishes the p53 deficiency-driven cellular morphological switch, MMP9 expression, and cancer cell dissemination. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

Vascular remodeling, in the uterus, during pregnancy is controlled by small populations of conventional Natural Killer cells that acidify the extracellular matrix (ECM) with a2V-ATPase that activates MMP9, degrades the ECM and releases pro-angiogenesis growth factors stored in the ECM. Hypoxic TME's that sustain excessive mitochondrial fission-fragmentation in NK cells would cause a2V-ATP activated MMP9 to similarly promote angiogenesis akin to Blastocyst implantation.  

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for the 'canary in the mine' of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis, normal immune signaling and response through to mitochondrial biogenesis, differentiation, angiogenesis, reduced immune signaling and response. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

The delicate balance in health and sensitivity of at least TP53 DNA is known to result in DNA to DNA and/or upstream RNA/protein interactions that influence mechanics of molecules and responses to ΔΨm variations. Here we have highlighted links between NK cell function relative to  mitochondrial polarization, ΔΨm and p53 relative to mitochondrial fission and immune signaling. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Angiogenic Growth Factor Flood

A previous series, about p53 culminated with "Blastocyst Development - A Perfected Cancer Model" that focused on the parallels in angiogenesis, triggered by blastocyst implantation and progression of tumors beyond ~1mm. Now, a recent study has found that conventional Natural Killer cells (cNK) control vascular remodeling in the uterus during pregnancy by acidifying the extracellular matrix (ECM) with a2V-ATPase that activates MMP-9 that degrades the ECM. Ablation of a2V-ATPase decreases Bax and p53 expression in testis and leads to implantation failure in the female mouse. The degrading ECM releases bound pro-angiogenic growth factors that contribute to Uterine artery (UtA) remodeling characterized by the loss of vascular smooth muscle cells (VSMCs) and dilation of the vessels. Without cNK, the UtA never lose VSMCs and UtA resistance remains high often leading to implantation failure.

Its logical that a timely flood of angiogenic growth factors, previously stored in the ECM would provide instant availability, but whether this explains the maternal-embryonic immune paradox remains to be determined? In the immune paradox maternal NK cells invade and maternal blood vessels are remodeled just before the arrival of trophoblasts, the external cells of the blastocyst, that carry male antigens during formation of the fetal placenta. A sudden flood of angiogenic factors preceding invading trophoblasts could provide the perfect environment required for maternal arterial/vascular remodeling.

Lymphocytes in the uterine lining (decidua) are dominated by a unique decidual natural killer (dNK) cell population. The dNK cell surface phenotype CD56bright CD16− CD3− and macrophages CD14+ CD206+(dMac) support a model whereby dNK cells, capable of killing extra-villous cytotrophoblasts (CTB), are prevented from doing so by neighboring macrophages thus protecting the fetal cells from NK cell attack. Existing research has centered on the function of the abundant and diverse sets of dNK, but now that cNK cells have been identified to play a more significant role, our understanding of the remodeling are likely to change.

In CTB exogenous p53 is able to down-regulate MMP-9 promoter activity, but endogenous p53 is not able to regulate MMP-9 expression in first trimester CTB cells. Inactivation of p53 through mutation is the most common trait in cancer. By loosing its onco-suppressive activity, p53 becomes oncogenic in almost all malignant tumors (Soussi and Lozano, 2005). Although p53 is not mutated in the human placenta, it has become functionally incompetent. Understanding why and how p53 is functionally incompetent in CTB might well be the key to understanding trophoblast invasion.

Downregulation of EMMPRIN (BSG,CD147) by p53 leads to a decrease in the activity of MMP-9 and an inhibition of tumor cell invasion. Upregulation of EMMPRIN seen in many cancers can be attributed to, at least in part, to the dysfunction of p53 and thus provides new evidence for the roles of p53 in tumor development and progression. Epithelial derived MMP-9 exhibits a novel defensive role of tumor suppressor in colitis associated cancer by activating MMP9-Notch1-ARF-p53 axis. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

The inter-activity of p53, cNK and MMP-9 are complexed, but this novel research may lead to the mechanisms by which arterial remodeling occurs after release of angiogenic factors from ECM. If that shares characteristics of NK invasion into developing tumor micro environment's a new therapeutic approach may arise.

 

Educating Perfect Natural Killers

Mining Tissue Match for Immune Co-culture

Mutant p53 knockdown in KPC (pancreatic ductal adenocarcinoma) cells of immune deficient mice had no effect on primary tumor growth, by contrast the reduced tumor growth in the immune-proficient syngeneic host was due to altered immune cell recruitment.

In vivo, the increased production of pro-inflammatory cytokines coupled with increased Natural Killer (NK) cell ligand expression permits the recruitment of immune cells and clearance of abnormal cells. Elimination of senescent tumors by NK cells may occur as a result of the cooperation of signals associated with p53 expression or senescence, which regulate NK cell recruitment, and other signals that induce NKG2D ligand expression on tumor cells.

Coculture of wild-type (wt) p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. Taken together findings define the involvement of p53 in the regulation of specific NKG2D ligands that enhance NK cell–mediated target recognition.

Inhibitory KIR-educated NK cells showed significantly increased expression of the glucose transporter Glut1 in comparison to NKG2A-educated or uneducated NK cells, with and without exposure to target cells. Educated NK cells displayed significantly higher rates of cellular glycolysis than uneducated NK cells indicating they may reside in different metabolic states prior to activation. The ability to metabolize glucose may represent a mechanism for the superior functionality of educated NK cells expressing KIR receptors. 

Cancer cells acquire immunoediting abilities by which they evade surveillance and escape eradication. Murine p53 missense mutation G242A (human G245A) suppresses activation of host NK cells, enabling breast cancer cells to avoid immune assault. Serial injection of EMT6 breast cancer cells that carry wild-type (wt) Trp53 promoted NK activity, while SVTneg2 cells carrying Trp53 G242A+/+ mutation decreased NK cell numbers and increased CD8+ T lymphocyte numbers in spleen. Upon co-culture with isolated NK cells, EMT6 cells activated NK cells and proliferation, increasing interferon-gamma (IFN-γ) production; however, SVTneg2 cells suppressed NK cell activation. p53 can modulate expression by cancer cells of Mult-1 and H60a activating and inhibitory ligands for NKG2D receptors of NK cells, respectively, to enhance immune surveillance against cancer. p53 is requisite for NK cell-based immune recognition and elimination of cancerous cells, and p53 missense mutant in cancer cells impairs NK cell responses.

NK cells are the oldest member of the innate lymphoid cell family (ILC) and the only representative of cytotoxic ILCs. These tissue-resident innate immune cells have a similar functional diversity to T cells including lineage-specifying transcription factors that drive certain effector programs. ILCs are present in almost every tissue, but strongly enriched at barrier surfaces, where they regulate immunity to infection, chronic inflammation, and tissue maintenance. ILCs orchestrate tissue homeostasis through their ability to sustain bidirectional interactions with epithelial cells, neurons, stromal cells, adipocytes, and many other tissue-resident cells. ILCs provide an integrated view on how immune responses in tissues are synchronized with functional relevance far beyond the classical view of the role of the immune system in discrimination between self/non-self and host defense.

Codondex has evidenced p53 genetic variations, in multiple samples of same biopsy tissue from pancreatic tumors and oral squamous cell carcinoma's that may distinguish host tumor tissue gradients. The effect of highly-specific tissue-selected cell co-culture to educate ILC/NK cells may enhance the prospect for tissue penetration by these expanded, activated cytotoxic cells to improve overall survival.  

Expanding Treatment Horizons

An unrecognized link between p53 function and the immunosurveillance of cancer and infection led to an understanding how p53 influences the expression of MHC molecules at the cell surface via binding interaction with endoplasmic reticulum ERAP1.

Targeted mutations in multiple cancers revealed TP53 gene expression ranged between the 89th and 100th percentile of all expressed transcripts, and raised the possibility that p53 peptides arising from these common mutations might be immunogenic in these patients.

Select KIR-HLA composition favoring antitumor activity could be a promising immunotherapeutic strategy against breast cancer using autologous activated Natural Killer (NK) cell clones. Coexistence of inhibitory and activating killer-cell immunoglobulin-like receptors (KIR) to the same cognate HLA-C2 and HLA-Bw4 ligands conferred breast cancer risk. Inhibitory KIR(iKIR)-HLA pairs without their activating KIR (aKIR)-HLA counterparts were significantly higher in normal controls. Contrarily and adding complexity this suggests NK cells expressing iKIR, to cognate HLA-ligands in the absence of specific aKIR counterparts are instrumental in antitumor response. 

Identification and characterization of the peptides presented by HLA-C, G and E molecules has been lacking behind the more abundant HLA-A and HLA-B gene products. The peptide specificities of these HLA molecules were elucidated using a comprehensive analysis of naturally presented peptides. The 15 most frequently expressed HLA-C alleles as well as HLA-E*01:01 and HLA-G*01:01 were transfected into lymphoblastoid C1R B-cells expressing low endogenous HLA. 

The results (above) include allotype C*02:02 for p53 presentation and indicate the overlap of HLA source protein and top 500 peptides demonstrating the enormous complexity for multivariate analysis of immune response. However,  C*02:02 and C*05:01 have identical contact residues for p8 and p9, the residues of the bound peptide that influences HLA-C interaction with KIR. This suggests peptide effects could contribute to the broader and stronger binding reactions of these two HLA-C allotypes. Interestingly SART3 and MAGEA3 proteins both interact through the p53 pathway and are reported in the peptide study (above) in addition to TP53 to present ligands on C*02:02 and C*05:01. 

Moreover, in vitro  models demonstrated that p53 is required for upregulation of NK ligands. Further, there was a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma (BCC), with a higher likelihood that KIR B carriers harbor abnormal p53 (p<0.004). Together the data suggests functional interactions between KIR and HLA modify risks of BCC and Squamous Cell Carcinoma and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors.

Notwithstanding the enormous complexity between iKIR, aKIR - HLA interactions, immunoterapy must address the highly specific characteristics of autologous precision and discover methods to sensitively educate NK cells so that minimally invasive treatments can be extended to patients who fall outside the patient cohort for strictly regulated treatments. 

Of course, its never that simple...

Retroviral Defense And Mitochondrial Offense

Chromosomal DNA has played host to the long game of viral insertions that repeat and continue as a genetic and epigenetic symbiosis along its phosphate and pentose sugar backbone. But, the bacterial origin of mitochondria and its hosted DNA also promotes its offense. 

Research suggests that retrovirus insertions evolved from a type of transposon called a retrotransposon. The evolutionary time scales of inherited, endogenous retroviruses (ERV) and the appearance of the zinc finger gene that binds its unique sequences occur over same time scales of primate evolution. Additionaly the zinc-finger genes that inactivate transposable elements are commonly located on chromosome 19. The recurrence of independent ERV invasions can be countered by a reservoir of zinc-finger repressors that are continuously generated on copy number variant (CNV) formation hotspots.

One of the more intiguing aspects of prevalent CNV hotspots on chromosome 19 are their proximity to killer immunoglobulin receptor gene's (KIR's) and other critical gene's of the innate immune system.

Frequently occuring DNA breaks can cause genomic instability, which is a hallmark of cancer. These breaks are over represented at G4 DNA quadruplexes within, hominid-specific, SVA retrotransposons and generally occur in tumors with mutations in tumor suppressor genes, such as TP53. Cancer mutational burden is shaped by G4 DNA, replication stress and mitochondrial dysfunction, that in lung adenocarcinoma downlregulates SPATA18, a mitochondrial eating protein (MIEAP) that contributes to mitophagy. 

Genetic variations, in non-coding regions can control the activity of conserved protein-coding genes resulting in the establishment of species-specific transcriptional networks. A chromosome 19 zinc finger, ZNF558 evolved as a suppressor of LINE-1 transposons, but has since been co-opted to singly regulate SPATA18. These variations are evident from a panel of 409 human lymphoblastoid cell lines where the lengths of the ZNF558 variable number tandem repeats (VNTR) negatively correlated with its expression. 

Colon cancer cells with p53 deletion were used to analyze deregulated p53 target genes in HCT116 p53 null cells compared to HCT116-p53 +/+ cells. SPATA18 was the most upregulted gene in the differential expression providing further insight to p53 and mitophagy via SPATA18-MIEAP.

p53 response elements (p53RE) can be shaped by long terminal repeats from endogenous retroviruses, long interspersed nuclear repeats, and ALU repeats in humans and fuzzy tandem repeats in mice. Further, p53 pervasively binds to p53REs derived from retrotransposons or other mobile genetic elements and can suppress transcription of retroelements. The p53- mediated mechanisms conferring protection from retroelements is also conserved through evolution. Certainly, p53 has been shown to have other roles in DNA  context, such as playing an important role in replication restart and replication fork progression. The absence of these p53-dependent processes can lead to further genomic instability. 

The frequency of variable length, long or short nucleotide repeats and their locations within a gene may be key to the repression of DNA sequences that would otherwise cause genomic instability or protein expressions that would eat bacterial mitochondria or destroy its cell host. 

The complexity of variable length insertions is made evident when exhaustively analyzing a simple length 12 sequence for the potential frequency of each of its variable length repeats starting from a minumum variable length of 8.

Then, for TGTGGGCCCACA(12)

All possible internal variable length combinations from and including length 8:

TGTGGGCC(8)|GTGGGCCC(8)|TGTGGGCCC(9)|TGGGCCCA(8)|GTGGGCCCA(9)|TGTGGGCCCA(10|GGGCCCAC(8)|TGGGCCCAC(9)|GTGGGCCCAC(10)|TGTGGGCCCAC(11)|GGCCCACA(8)|GGGCCCACA(9)|TGGGCCCACA(10)|GTGGGCCCACA(11)|TGTGGGCCCACA(12)

For example, reviewing length (8) only:

TGTGGGCC (8) occurs 5 times

GTGGGCCC (8) occurs 8 times

TGGGCCCA (8) occurs 9 times

GGGCCCAC (8) occurs 8 times

GGCCCACA (8) occurs 5 times

Any repeat can be ranked based on its ocurrence within all possible combinations of a given sequence, known as the repeats' iScore rank. This illustrates a potential useful statistical ranking that, subject to biology may describe a repeats inherency to be more or less effective, in increments of the gene sequence. 

Repression of the most active sequences, especially in context of repeats may result in genetic variation. 

Chemo vs. Mecho

Data strongly suggests interaction between plasma membrane and submembrane at the endothelial surface controls the inflammatory response. 

A meta-analysis from six studies of global gene expression profiles of Blood Pressure (BP) and hypertension was performed in 7017 individuals. 34 genes were differentially expressed. Of these, 6 genes were linked including MYADM, which was the only gene, of 34 discovered across diastolic, systolic BP and hypertension. Knockdown of MYADM (19q13), a component of endothelial surface rafts induced an inflammatory phenotype altering barrier function through the increase of the adhesion receptor ICAM-1 (19p13). This is mediated by MYADM activation of ERM actin cytoskeleton proteins. 

Mechanical forces, without a definitive direction e.g., disturbed flow and relatively undirected stretch at branch points and other complex regions cause sustained molecular signaling of pro-inflammatory and proliferative pathways that include mechanical stretch tied to p53. 

ERM proteins also facilitate Sphingosine-1-phosphate (S1P) dependent egress for T-cells to migrate from lymphoid organs. Their directional migration, by blebbing is contained at the T-cell’s leading edge. This fundamentally different mode of migration is characterized by intracellular pressurization. Of the five S1P receptors S1P2 (19p13) is critical in the immune, nervous, metabolic, cardiovascular, musculoskeletal, and renal systems. Results suggest that the ratio between S1P1 and S1P2 (19p13) governs the migratory behavior of different T cell subsets. 

Human NK cells express S1P1 mRNA. Activation with IL-2 increases S1P1, promotes S1P4 (19p13) and S1P5 (19p13) but not S1P2 (19p13) expression. Unlike S1P1, S1P2 (19p13) signals through several different G-alpha subunits, Gi, G12/13, and Gq. S1P5 (19p13) is also expressed in human and mouse NK cells and was required for mobilization to inflamed organs. S1P5-deficient mice had aberrant NK cell homing during steady-state conditions. NK cell trafficking in vivo requires a dedicated sphingosine 1-phosphate receptor. 

Virus-infected mast cells selectively recruit NK cells and positively modulate their functions through mechanisms dependent on soluble mediators, such as interferons. Skin mast cells protect mice against vaccinia virus by triggering mast cell receptor S1P2 (19p13) and releasing antimicrobial peptides. S1P2 (19p13),  a negative regulator of platelet derived growth factor (PDGF) induced migration and proliferation as well as SphK1 expression. 

S1P inhibits macropinocytosis (internalizing extracellular materials) and phosphorylation of Akt via S1P2 (19p13) stimulation resulting in diminished antigen capture.

S1P1, S1P2 (19p13) and S1P3 receptors have redundant or cooperative functions for the development of a stable and mature vascular system during embryonic development. S1P2 (19p13)  and S1P3 are involved in regulation of endothelial barrier function, fibrosis, and vasoconstriction. 

Adipogenic differentiation is inhibited by S1P2 (19p13) as mediated by C/EBPα and PPARγ, which induces PEPCK, a more recent gene of interest in cancer that acts at the junction between glycolysis and the Krebs cycle.

Mecho or chemo, chicken or egg, what first?