Pathogens And Immunity - Mutual Memories

The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 

All Roads Lead to (Ch)Romosome 19!

A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

A pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure. 

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

ΔΨm and Immune Responses to Disease

Each cell contains hundreds to thousands of mitochondria, each with hundreds of electron transport chain complexes (ETC) that deliver ATP as the cells primary energy source and the central dogma of eukaryote existence. ETC function's, on the inner mitochondrial membrane, are sensitive to change in electric charge represented as mitochondrial polarization and mitochondrial membrane potential (ΔΨm). The large responsive surface area of the outer and inner membrane promotes remodeling and protein interactions that may lead to cellular diseases including cancer.

Tumor Necrosis Factor (TNF) causes mitochondria to relocate, to bind the nucleus and efficiently shuttle elements that enable fast DNA transcription and signaling that, under certain conditions, may suppress the pro inflammatory immune response. TNF signaling to mitochondrial PINK1 stabilizes ubiquitin chains that result in mitochondrial relocation and shuttling activated p65 that increases NF-κB transcription in the nucleus. This anti-apoptotic response resembles the feed forward activation loop in Pink1/Parkin-dependent mitophagy as an independent defense against accumulation of dysfunctional mitochondria, that under physiological conditions integrate their roles in innate immune signaling and stress. 

Enhanced activation of NF-κB by TNF, via mutant p53, concomitantly suppressed the pro-apoptotic effect of TNF leading to increased invasiveness of cancer cells. Accordingly mutant p53 may directly affect nuclear accumulation and retention of p65 upon cytokine exposure as mutant p53 overexpression and nuclear p65 staining in tumors strongly correlated.

Stresses elicited by aneuploid states in cells mediate interaction between Natural Killer (NK) cells. In highly aneuploid cancer cell lines NF-κB signaling is upregulated and activated promoting immune clearance by NK cells, but anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Rapid NF-κB signaling may be preferentially selected because it antagonizes p53, known to inhibit the growth of highly aneuploid cells. Significantly increased mitochondrial DNA in aneuploid cells may result from increased fission of mitochondria, similar to that found in extreme ploidy during Oocyte development. Perhaps supporting the reason in embryonic stem cells (ESC) apoptosis occurs independent of p53 and protein kinase Akt3, the regulator of ESC apoptosis, suppresses p53 for the survival and proliferation of these stem cells.

A comprehensive metabolic analysis identified mitochondrial polarization as a gatekeeper of NK cell priming, activation, and function. Mitochondrial fusion and OXPHOS promote long-term persistence and improve cytokine production by NK cells. Hypoxic Tumor Micro Environments (TME) sustained NK cell activation of mTOR-Drp1, which resulted in excessive mitochondrial fission and fragmentation. Inhibition of fragmentation improved mitochondrial metabolism, survival and the antitumor capacity of NK cells. 

Mitochondrial biogenesis also requires the initiation of Drp1-driven fission. Whereas, fissions from dysfunction are associated with diminished ΔΨm and Reactive Oxygen Species (ROS), which are unchanged in this biogenesis. Depletion of p53 exaggerates fragmentation, but does not affect ΔΨm and ROS levels. Instead, p53 depletion activates mTORC1/4EBP1 signaling that regulates MTFP1 protein expression to govern Drp1-mediated fission. Thus, increased fission upon p53 loss can stimulate biogenesis, but not accumulation of damaged mitochondria. This may explain how mitochondrial integrity, in context of p53 deficiency induced fragmentation, may suppress immune signaling.

Downregulating p53 expression or elevating the molecular signature of mitochondrial fission correlates with aggressive tumor phenotypes and poor prognosis in cancer patients. Upon p53 loss, exaggerated fragmentation stimulates the activation of ERK1/2 signaling resulting in epithelial-to-mesenchymal transition-like changes in cell morphology, accompanied by accelerated MMP9 expression and invasive cell migration. Notably, blocking the activation of mTORC1/MTFP1/Drp1/ERK1/2 axis completely abolishes the p53 deficiency-driven cellular morphological switch, MMP9 expression, and cancer cell dissemination. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

Vascular remodeling, in the uterus, during pregnancy is controlled by small populations of conventional Natural Killer cells that acidify the extracellular matrix (ECM) with a2V-ATPase that activates MMP9, degrades the ECM and releases pro-angiogenesis growth factors stored in the ECM. Hypoxic TME's that sustain excessive mitochondrial fission-fragmentation in NK cells would cause a2V-ATP activated MMP9 to similarly promote angiogenesis akin to Blastocyst implantation.  

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for the 'canary in the mine' of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis, normal immune signaling and response through to mitochondrial biogenesis, differentiation, angiogenesis, reduced immune signaling and response. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

The delicate balance in health and sensitivity of at least TP53 DNA is known to result in DNA to DNA and/or upstream RNA/protein interactions that influence mechanics of molecules and responses to ΔΨm variations. Here we have highlighted links between NK cell function relative to  mitochondrial polarization, ΔΨm and p53 relative to mitochondrial fission and immune signaling. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Educating Perfect Natural Killers

Mining Tissue Match for Immune Co-culture

Mutant p53 knockdown in KPC (pancreatic ductal adenocarcinoma) cells of immune deficient mice had no effect on primary tumor growth, by contrast the reduced tumor growth in the immune-proficient syngeneic host was due to altered immune cell recruitment.

In vivo, the increased production of pro-inflammatory cytokines coupled with increased Natural Killer (NK) cell ligand expression permits the recruitment of immune cells and clearance of abnormal cells. Elimination of senescent tumors by NK cells may occur as a result of the cooperation of signals associated with p53 expression or senescence, which regulate NK cell recruitment, and other signals that induce NKG2D ligand expression on tumor cells.

Coculture of wild-type (wt) p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. Taken together findings define the involvement of p53 in the regulation of specific NKG2D ligands that enhance NK cell–mediated target recognition.

Inhibitory KIR-educated NK cells showed significantly increased expression of the glucose transporter Glut1 in comparison to NKG2A-educated or uneducated NK cells, with and without exposure to target cells. Educated NK cells displayed significantly higher rates of cellular glycolysis than uneducated NK cells indicating they may reside in different metabolic states prior to activation. The ability to metabolize glucose may represent a mechanism for the superior functionality of educated NK cells expressing KIR receptors. 

Cancer cells acquire immunoediting abilities by which they evade surveillance and escape eradication. Murine p53 missense mutation G242A (human G245A) suppresses activation of host NK cells, enabling breast cancer cells to avoid immune assault. Serial injection of EMT6 breast cancer cells that carry wild-type (wt) Trp53 promoted NK activity, while SVTneg2 cells carrying Trp53 G242A+/+ mutation decreased NK cell numbers and increased CD8+ T lymphocyte numbers in spleen. Upon co-culture with isolated NK cells, EMT6 cells activated NK cells and proliferation, increasing interferon-gamma (IFN-γ) production; however, SVTneg2 cells suppressed NK cell activation. p53 can modulate expression by cancer cells of Mult-1 and H60a activating and inhibitory ligands for NKG2D receptors of NK cells, respectively, to enhance immune surveillance against cancer. p53 is requisite for NK cell-based immune recognition and elimination of cancerous cells, and p53 missense mutant in cancer cells impairs NK cell responses.

NK cells are the oldest member of the innate lymphoid cell family (ILC) and the only representative of cytotoxic ILCs. These tissue-resident innate immune cells have a similar functional diversity to T cells including lineage-specifying transcription factors that drive certain effector programs. ILCs are present in almost every tissue, but strongly enriched at barrier surfaces, where they regulate immunity to infection, chronic inflammation, and tissue maintenance. ILCs orchestrate tissue homeostasis through their ability to sustain bidirectional interactions with epithelial cells, neurons, stromal cells, adipocytes, and many other tissue-resident cells. ILCs provide an integrated view on how immune responses in tissues are synchronized with functional relevance far beyond the classical view of the role of the immune system in discrimination between self/non-self and host defense.

Codondex has evidenced p53 genetic variations, in multiple samples of same biopsy tissue from pancreatic tumors and oral squamous cell carcinoma's that may distinguish host tumor tissue gradients. The effect of highly-specific tissue-selected cell co-culture to educate ILC/NK cells may enhance the prospect for tissue penetration by these expanded, activated cytotoxic cells to improve overall survival.  

Evidence of Purposeful Evolution

Darwin's evolution challenged!

A recently published article in Nautre challenged evolution theory suggesting DNA repair was the more likely candidate driving evolutionary development than the environmental conditions thought to be the driver of natural selection. In some sense the two may be linked, but this study showed how epigenome-associated mutation bias reduced the occurrence of deleterious mutations, challenging the prevailing paradigm that mutation is a directionless force in evolution.

Quantitative assessment of DNA gain and loss through DNA double-strand break (DSB) repair processes suggests deletion-biased DSB repair causes ongoing genome shrinking in A. thaliana, whereas genome size in barley remained nearly constant.

Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DSB repair. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome.

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate Natural Killer (NK) cells are unable to express RAGs or RAG endonuclease activity during ontogeny. They exhibit a cell-intrinsic hyperresponsiveness, but a diminished capacity to survive following virus-driven proliferation, a reduced expression of DNA damage response mediators, and defects in the repair of DNA breaks. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors marks functionally distinct subsets of NK cells in the periphery, demonstrating a novel role for RAG in the functional specialization of the NK cell lineage. 

The most active region of Human Chromosome 19 has a long history of recombinations that define the expression patterns of telomeric and centromeric proportions of Killer-cell immunoglobulin-like receptor (KIR) gene's encoding receptors. KIR's bind cells presenting MHC class 1 HLA haplotype combinations, that vary significantly across tissues in different population groups. Further, the deletion rate in Zinc Finger clusters (ZNF) located around 19q13.42, near KIR and C19MC between 51,012,739 and 55,620,741 are about twofold higher than the background deletion rate. 

The relationship between deletions and mutation may indeed play a direct role in rapidly evolving, innate immunity. This may just begin to explain the speed at which global populations can respond and survive pandemics caused by the likes of COVID-19. And, the '19' in its nomenclature may go beyond time to the very chromosome responsible for innate immune diversity.

Retroviral Defense And Mitochondrial Offense

Chromosomal DNA has played host to the long game of viral insertions that repeat and continue as a genetic and epigenetic symbiosis along its phosphate and pentose sugar backbone. But, the bacterial origin of mitochondria and its hosted DNA also promotes its offense. 

Research suggests that retrovirus insertions evolved from a type of transposon called a retrotransposon. The evolutionary time scales of inherited, endogenous retroviruses (ERV) and the appearance of the zinc finger gene that binds its unique sequences occur over same time scales of primate evolution. Additionaly the zinc-finger genes that inactivate transposable elements are commonly located on chromosome 19. The recurrence of independent ERV invasions can be countered by a reservoir of zinc-finger repressors that are continuously generated on copy number variant (CNV) formation hotspots.

One of the more intiguing aspects of prevalent CNV hotspots on chromosome 19 are their proximity to killer immunoglobulin receptor gene's (KIR's) and other critical gene's of the innate immune system.

Frequently occuring DNA breaks can cause genomic instability, which is a hallmark of cancer. These breaks are over represented at G4 DNA quadruplexes within, hominid-specific, SVA retrotransposons and generally occur in tumors with mutations in tumor suppressor genes, such as TP53. Cancer mutational burden is shaped by G4 DNA, replication stress and mitochondrial dysfunction, that in lung adenocarcinoma downlregulates SPATA18, a mitochondrial eating protein (MIEAP) that contributes to mitophagy. 

Genetic variations, in non-coding regions can control the activity of conserved protein-coding genes resulting in the establishment of species-specific transcriptional networks. A chromosome 19 zinc finger, ZNF558 evolved as a suppressor of LINE-1 transposons, but has since been co-opted to singly regulate SPATA18. These variations are evident from a panel of 409 human lymphoblastoid cell lines where the lengths of the ZNF558 variable number tandem repeats (VNTR) negatively correlated with its expression. 

Colon cancer cells with p53 deletion were used to analyze deregulated p53 target genes in HCT116 p53 null cells compared to HCT116-p53 +/+ cells. SPATA18 was the most upregulted gene in the differential expression providing further insight to p53 and mitophagy via SPATA18-MIEAP.

p53 response elements (p53RE) can be shaped by long terminal repeats from endogenous retroviruses, long interspersed nuclear repeats, and ALU repeats in humans and fuzzy tandem repeats in mice. Further, p53 pervasively binds to p53REs derived from retrotransposons or other mobile genetic elements and can suppress transcription of retroelements. The p53- mediated mechanisms conferring protection from retroelements is also conserved through evolution. Certainly, p53 has been shown to have other roles in DNA  context, such as playing an important role in replication restart and replication fork progression. The absence of these p53-dependent processes can lead to further genomic instability. 

The frequency of variable length, long or short nucleotide repeats and their locations within a gene may be key to the repression of DNA sequences that would otherwise cause genomic instability or protein expressions that would eat bacterial mitochondria or destroy its cell host. 

The complexity of variable length insertions is made evident when exhaustively analyzing a simple length 12 sequence for the potential frequency of each of its variable length repeats starting from a minumum variable length of 8.

Then, for TGTGGGCCCACA(12)

All possible internal variable length combinations from and including length 8:

TGTGGGCC(8)|GTGGGCCC(8)|TGTGGGCCC(9)|TGGGCCCA(8)|GTGGGCCCA(9)|TGTGGGCCCA(10|GGGCCCAC(8)|TGGGCCCAC(9)|GTGGGCCCAC(10)|TGTGGGCCCAC(11)|GGCCCACA(8)|GGGCCCACA(9)|TGGGCCCACA(10)|GTGGGCCCACA(11)|TGTGGGCCCACA(12)

For example, reviewing length (8) only:

TGTGGGCC (8) occurs 5 times

GTGGGCCC (8) occurs 8 times

TGGGCCCA (8) occurs 9 times

GGGCCCAC (8) occurs 8 times

GGCCCACA (8) occurs 5 times

Any repeat can be ranked based on its ocurrence within all possible combinations of a given sequence, known as the repeats' iScore rank. This illustrates a potential useful statistical ranking that, subject to biology may describe a repeats inherency to be more or less effective, in increments of the gene sequence. 

Repression of the most active sequences, especially in context of repeats may result in genetic variation. 

Chemo vs. Mecho

Data strongly suggests interaction between plasma membrane and submembrane at the endothelial surface controls the inflammatory response. 

A meta-analysis from six studies of global gene expression profiles of Blood Pressure (BP) and hypertension was performed in 7017 individuals. 34 genes were differentially expressed. Of these, 6 genes were linked including MYADM, which was the only gene, of 34 discovered across diastolic, systolic BP and hypertension. Knockdown of MYADM (19q13), a component of endothelial surface rafts induced an inflammatory phenotype altering barrier function through the increase of the adhesion receptor ICAM-1 (19p13). This is mediated by MYADM activation of ERM actin cytoskeleton proteins. 

Mechanical forces, without a definitive direction e.g., disturbed flow and relatively undirected stretch at branch points and other complex regions cause sustained molecular signaling of pro-inflammatory and proliferative pathways that include mechanical stretch tied to p53. 

ERM proteins also facilitate Sphingosine-1-phosphate (S1P) dependent egress for T-cells to migrate from lymphoid organs. Their directional migration, by blebbing is contained at the T-cell’s leading edge. This fundamentally different mode of migration is characterized by intracellular pressurization. Of the five S1P receptors S1P2 (19p13) is critical in the immune, nervous, metabolic, cardiovascular, musculoskeletal, and renal systems. Results suggest that the ratio between S1P1 and S1P2 (19p13) governs the migratory behavior of different T cell subsets. 

Human NK cells express S1P1 mRNA. Activation with IL-2 increases S1P1, promotes S1P4 (19p13) and S1P5 (19p13) but not S1P2 (19p13) expression. Unlike S1P1, S1P2 (19p13) signals through several different G-alpha subunits, Gi, G12/13, and Gq. S1P5 (19p13) is also expressed in human and mouse NK cells and was required for mobilization to inflamed organs. S1P5-deficient mice had aberrant NK cell homing during steady-state conditions. NK cell trafficking in vivo requires a dedicated sphingosine 1-phosphate receptor. 

Virus-infected mast cells selectively recruit NK cells and positively modulate their functions through mechanisms dependent on soluble mediators, such as interferons. Skin mast cells protect mice against vaccinia virus by triggering mast cell receptor S1P2 (19p13) and releasing antimicrobial peptides. S1P2 (19p13),  a negative regulator of platelet derived growth factor (PDGF) induced migration and proliferation as well as SphK1 expression. 

S1P inhibits macropinocytosis (internalizing extracellular materials) and phosphorylation of Akt via S1P2 (19p13) stimulation resulting in diminished antigen capture.

S1P1, S1P2 (19p13) and S1P3 receptors have redundant or cooperative functions for the development of a stable and mature vascular system during embryonic development. S1P2 (19p13)  and S1P3 are involved in regulation of endothelial barrier function, fibrosis, and vasoconstriction. 

Adipogenic differentiation is inhibited by S1P2 (19p13) as mediated by C/EBPα and PPARγ, which induces PEPCK, a more recent gene of interest in cancer that acts at the junction between glycolysis and the Krebs cycle.

Mecho or chemo, chicken or egg, what first?

Immunity keeping p53 in check!

In a 2012 study on the topology of the human and mouse m6A RNA methylomes, Gene Ontology (GO) analysis of differentially expressed genes (DEG's) indicated a noteworthy enrichment of the p53 signaling pathway: 22/23 genes had differentially expressed splice variants, of which 18 were methylated. Moreover, 15 other members of the signaling pathway, which were not significant DEG's, exhibited significant differential isoform expressions. For example, isoforms of MDM4, needed for p53 inactivation were downregulated. Similar pro-apoptotic effects were observed in other pathway genes including MDM2, FAS and BAX. Higher apoptosis rate in HaCaT-T cells resulted with knockdown of m6A subunit METTL3, which also reversed a significant decrease in p53 activity. Modulation of p53 signaling through splicing may be relevant to induction of apoptosis by silencing of METTL3. 

Then, in 2019 a study of arsenite-induced human keratinocyte transformation demonstrated that knockdown of METTL3 significantly decreased m6A level, restored p53 activation and inhibited cellular transformation phenotypes in the-transformed cells. Further, m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A also upregulated expression of negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. Taken together, the study revealed the novel role of m6A in mediating human keratinocyte transformation by suppressing p53 activation and sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.

Finally in 2021 a discovery that YTHDF2 is upregulated in NK cells upon activation by cytokines, tumors, and cytomegalovirus infection. Ythdf2 deficiency in NK cells impaired its anti-tumor and anti-viral activity in vivo. YTHDF2 maintains NK cell homeostasis and terminal maturation, correlating with modulating NK cell trafficking and regulating Eomes, respectively. It promotes NK cell effector function and is required for IL-15-mediated NK cell survival and proliferation by forming a STAT5-YTHDF2 positive feedback loop. Analysis showed significant enrichment in cell cycle, division, and division-related processes, including mitotic cytokinesis, chromosome segregation, spindle, nucleosome, midbody, and chromosome. This data supports roles of YTHDF2 in regulating NK proliferation, survival, and effector functions. Transcriptome-wide screening identified Tardbp (TDP-43) to be involved in cell proliferation or survival as a YTHDF2-binding target in NK cells.

Downregulation of METTL3, which in spinal cord contributes with YTHDF2 to modulate inflammatory pain may upregulate differentially expressed p53 network splice variants that oppose YTHDF2 induced downregulation of p53, via PRDM2 leading to apoptotic or diseased cells. In diseased environments cytokines may upregulate YTHDF2 in NK cells leading to downregulation of p53 and cytoskeletal transformation that may be sufficient, at an immune synapse to advance cytolysis.

p53 signals may inform selections of cells and tissue that prime NK cells for advanced, personalized immune therapy. 

First Intron DNA - Site for a Genetic Brain?

DNA Methylation

The first intron of a gene, regardless of tissue or species is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Therefore, it is an informative gene feature regarding the relationship between DNA methylation and gene expression. But, expression in induced pluripotent stem cells (iPSC's) has been a major challenge to the stem cell industry, because by comparison these cells have not yet reached the state of natural pluripotent or embryonic stem cells (ESC's).

In mice two X chromosomes (XC) are active in the epiblasts of blastocysts as well as in pluripotent stem cells. One XC is inactivated triggered by Xist (non coding) RNA transcripts coating it to become silent. Designer transcription factor (dTF) repressors, binding the Xist intron 1 enhancer region caused higher H3K9me3 methylation and led to XC's opening and X-linked gene repression in MEFs. This substantially improved iPSC production and somatic cell nuclear transfer (SCNT) preimplantation embryonic development. This also correlated with much fewer abnormally expressed genes frequently associated with SCNT, even though it did not affect Xist expression. In stark contrast, the dTF activator targeting the same enhancer region drastically decreased both iPSC generation and SCNT efficiencies and induced ESC differentiation. 

A genome-wide, tissue-independent quasi-linear, inverse relationship exists between DNA methylation of the first intron and gene expression. More tissue-specific, differentially methylated regions exist in the first intron than in any other gene feature. These have positive or negative correlation with gene expression, indicative of distinct mechanisms of tissue-specific regulation. CpGs in transcription factor binding motifs are enriched in the first intron and methylation tends to increase with distance from the first exon–first intron boundary, with a concomitant decrease in gene expression.

Since the relationship between sequence, methylation, repression and transcription is determinative in ESC differentiation it may also suggest a broader link to differential translation. Translation is required for miRNA-dependent transcript destabilization that alters levels of coding and noncoding transcripts. But, steady-state abundance and decay rates of cytosolic long non-coding RNA's (lncRNAs) are insensitive to miRNA loss. Instead lncRNAs fused to protein-coding reporter sequences become susceptible to miRNA-mediated decay. 

In this model, first intron DNA sequences that are differentially methylated, bind transcription factors that effect transcription, impact splicing, expressions of coding or non-coding transcripts and transcript destabilizations resulting in differential rates and possible variations in translation. This bottom-up, dynamic view of the classical process may elevate the first intron from 'junk' to a DNA 'brain' because it plays a more extensive role, heading the process toward translation of any gene or switching it off entirely.  

For this reason, among others Codondex uses first intron k-mers relative to the transcripts mRNA as the basis for comparing same gene transcripts in diseased cells or tissue samples. Further, p53 and BRCA1 miRNA key sequences, discovered using Codondex iScore algorithm, when transfected into HeLa cells resulted in significantly reduced proliferation that may result from this accelerated, transfected miRNA dependent decay.

 

Short Sequences of Proximally Disordered DNA

Oxford Nanopore Device Reducing Sequencing Cost

Relationships exist between short sequences of proximal DNA (SSPD) of a gene that when transcribed into RNA present stronger or weaker binding attractions to RNA binding proteins (RBP'S) that settle, edit, splice and resolve messenger RNA (mRNA). Responsive to epigenetic stimuli on Histones and DNA, mRNA are constantly transcribed in different quantity, at different times such that different mRNA strands are transported from the nucleus to cytoplasm where they are translated into and produce any of more than 30,000 different proteins.

Single nucleotide polymorphisms and DNA mutations can alter SSPD combinations in different diseased cells thus altering sequence proximity, ordering that affects transcribed RNA's attraction and optimal binding of RBP's. This may result in modified splicing of RNA, assembly of mRNA and slight or major variations in some or all translated protein derived from that gene. 

The specific effects of these DNA variations, on the multitude of proteins produced are generally unknown. However, it remains important to understand their effects in disease, diagnosis and therapy. Typically these have historically been researched by large scale analysis of RBP on RNA as opposed to the more fundamental, yet underrepresented massive array of diseased variant DNA to mRNA transitions.

Most pharmaceutical research is directed to a molecular interference targeting an aberrant protein to cure widely represented or highly impactful disease conditions of society. Economic assessments generally influence government decisions to support research based on loss of GDP contribution by a specific disease in a  patient cohort. However, in the modern multi-omics era top down research into protein-RNA activity is descending deeper into the cell to include RNA-mRNA and mRNA-DNA customizable therapies that will eventually resolve individually assessed diseases at a price that addresses much larger array of patient needs.  

SNP's and other mutations can vary considerably in cells. These variations can cause instability during division and lead to translated differences that can ultimately drive cancerous cell growth to escape patient immunity. Like a 'whack-a-mole' game, pattern variation and mechanistic persistence eventually beat the player. Without effective immune clearance these cells can replicate into tumors and contribute to microenvironments that support their existence.

Link to video on tumor microenvironment https://youtu.be/Z9H2utcnBic

We thought to analyze DNA and mRNA transcripts from cells in tumors and their microenvironments to see if we could expose the SSPD disordered combinations that may have promoted sub-optimal RBP attractions and led to sustained immune escape. Given the complexity of DNA to mRNA transcription, for any given gene many distortions in gene data sets have to be filtered. To do that we focused on p53, the most mutated gene in cancer. We designed a method to compare sequences arrays of DNA and mRNA Ensembl transcripts, from the consensus of healthy patients to multiple cell samples extracted from different sections of a patients tumor and tumor microenvironment.     

We previously identified and measured different levels of Natural Killer (NK) cell cytotoxicity, produced from cocultures with the extracted samples of each of the multiple sites of a biopsy. We will measure the different p53 transcript SSPD combinations associated with each sample and determine whether disordered SSPD's corelate with NK cytotoxicity from each coculture. We expect to identify whether biopsied tumor cells, ranked by SSPD's predict the cytotoxicity resulting from NK cell cocultures. We will narrow our research to identify the varied expressions of receptor combinations associated with degrees of cytotoxicity. We will test immune efficacy to lyse and destroy tumor cells. Finally we will test for adaptive immune response. 

Our vision is for per-patient, predictable cell co-culture pairings, for innate immune cell education based on ranking DNA-mRNA combinations to lead to multiple effective therapies. The falling cost of sequencing and sophistication of GMP laboratories presently servicing oncologists may support a successful use of this analytical approach to laboratory assisted disease management.

   

 

Non-Coding DNA Key Sequences

DNA Structural Inherency

Wind two strands of elastic, eventually it will knot, ultimately it will double up on itself. Separate the strands. From the point of unwinding, forces will be directed to different regions and the separation will approximately return to the wound state of the band. Do the same with each of 10 different bands or strings of any type, they will all behave in much the same way. For a given section of DNA being transcribed, the effect of separation will be much the same. For a given gene, there will be sequences that can tolerate force to greater or lesser degrees. For different transcripts, of a gene variation at those sequences may be crucial to the integrity of transcription machinery that separates DNA strands to initiate replication to RNA and for the outcome.

Cellular biology is enormously complex in all regards. The physics of molecular interaction, fluid dynamics, and chemistry combine in a system where cause and effect is near impossible to predict. At the most elementary level we hypothesize some non-coding DNA (ncDNA) possess structural inherencies that can be deployed to direct gene proteins and cell function for diagnosis or therapy.

Coding DNA and its regulatory, non-coding gene compliment is transcribed and spliced from a transcribed gene. Transcription to RNA, edited mRNA, spliced non-coding RNA and ultimately mRNA translation to protein can produce wide ranging, variable outcomes that may not be re-captured experimentally. 

A single nucleotide polymorphism (SNP) or SNP combinations within a gene may affect the finely tuned balance that results. Under different environmental conditions this could be material to the protein produced. Additionally other mutations of the gene could add complexity to the environment and/or the  resulting protein translation. 

At this level of cellular biology, genetic DNA stores instruction for protein assemblies to produce new protein required for the fully functional cell. However, DNA's stored mutations can lead to different functional or non-functional versions of protein depending on many different factors. Relationships between ncDNA, including mutations and the transcripts' edited, protein coding mRNA may represent unexplored inherencies that can regulate the gene's mRNA or translated protein.

We built an algorithm to elaborately compare ncDNA sequences of multiple protein coding transcripts of the same gene. For each transcript it steps through every variable length ncDNA sequence (kmer) (specifically intron1), computes a signature for each and indexes it to the constant of the transcripts' mRNA signature. For each step these signatures order the kmers for each of the transcript's. The order is represented in a vector of all the transcripts being compared.  

At millions of successive steps (depending on total intron 1 length's) transcripts mostly retain their vector ordering except, as expected at a kmer length change. Mostly transcript order in the vector does not change, occasionally a few positions change, vary rarely do all positions change. Position changes that cause another, like a domino effect are filtered out. For the rarest positions changes at a step, we look to the root causes in the kmer (sequence). We call this a Key Sequence because it is identified by the significance of changes to transcript positions in the vector compared to the vector at the next step. 

Therefore, Key Sequences cause the most position changes between transcripts being compared by the algorithm. This relative measure is step dependent and Key Sequences are discovered by comparing transcript positions in the vector at the next step location. Logically, this infers a genes structural inherency discovered through ncDNA Key Sequence relationships to mRNA, to other transcripts, error in gene alignments, sequenced reads or the algorithm. 

In assay testing we were able to predict and synthesize non-coding RNA Key Sequences that significantly reduced proliferation of HeLa cells. In our pre-clinical work, based on comparisons to transcripts of the TP53 we will be predicting the efficacy of cell and tissue selections that educate and activate Natural Killer cells.

If Key Sequences are inherent they could open a new frontier for diagnosis and therapy.

Custom Immunotherapy To Address Dimorphic Complexities.

Dimorphic relationships between genes on Chromosome (Chr)6, encoding Human Leukocyte Antigens (HLA) and those on Chr19, encoding Killer-cell immunoglobulin-like receptors (KIRs) may eventually uncover important information as to how, why and when Natural Killer (NK) cells determine self restraint or attack cells infected by pathogens and disease. These proteins emerge from their respective zones, on each chromosome that have and continue to be subject to frequent recombination events.

The active region of Chr19 has a long history of recombinations that have and continue to define the expression patterns of telomeric and centromeric proportions of KIR gene's encoding receptors that bind cells presenting MHC class 1, HLA haplotype combinations that vary significantly across tissues in different population groups. Adding complexity, HLA genes on Chr6 are also subject to significant recombination making the dimorphic functional HLA-KIR interactions difficult to predict. 

Studies across population groups reveal the great diversity of HLA-KIR dimorphisms. The Southern Han centromeric KIR region encodes strong, conserved, inhibitory HLA-C-specific receptors, and the telomeric region provides a high number and diversity of inhibitory HLA-A and -B-specific receptors. In all these characteristics, the Chinese Southern Han represent other East Asians, whose NK cell repertoires are thus enhanced in quantity, diversity, and effector strength, likely augmenting resistance to endemic viral infections.

One study goes much further suggesting that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered p53 in BCC tumors. This preference implicates multi-modal p53 mechanisms that are also known to upregulate NK ligands, induce HLA-A11 assembly against Epstein Bar Virus and bind a frequently mutated p53 peptide in a complex with HLA-A and presented at the cell surface that prevent T-Cell response. In support, selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

In addition to KIR, adaptive NKG2C+ NK cells display fine peptide specificity selectively to recognize HCMV strains that differed by a single substitution in the HLA-E-binding UL40-derived peptide during infection. Distinct peptides controlled the degree of proliferation in synergy with pro-inflammatory cytokines. Viral peptides are known to augment inhibition at NKG2A. Conversely, NKG2A+ NK cells sense MHC class I downregulation more efficiently than KIRs. Thus, both receptor:ligand systems appear to have complementary functions in recognizing changes in MHC class I.

Polymorphic landscapes across HLA, KIR and NKG receptor repertoires coupled with receptor:ligand haplotype cross referencing makes it near impossible to predict therapeutic targets across the breadth of disease and disease combinations that affect populations. A recent KIR-HLA co-existence study of haplotypes in Breast Cancer patients and controls highlights this complexity. 

Genetic signatures that target discovery of desired cell functionality to select preferential cells/tissues from micro environments used to educate and license autologous or allogeneic NK cells may tease specific, finely tuned, intact receptor repertoires. Once licensing efficacy is reached, expanding NK cell populations and applying them to act upon previously unrecognizable cells of a patient becomes the next frontier of immune therapy. This is the exciting work presently being undertaken by researchers and staff working with Precision Autology using Codondex methodologies. 

Genetic Eruption and p53 Response!

L1 are a class of transposable DNA elements found in 17% of the genome that are evolutionarily associated with primitive viral origins. Around 100 have retained the ability to retrotranspose. Without restraint they can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can further impact genome variation by mispairing and unequal crossing-over during meiosis due to its repetitive DNA sequences. Indeed, meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

189 gastrointestinal cancer patients across three cancer types: 95 stomach, colorectal esophageal were examined for any aberration in DNA repair pathways that could be associated with L1 retro-transposition. Out of 15 DNA repair pathways, only the TP53 repair pathway showed a significant association. L1 retro-transposition is inversely correlated with expression of immunologic response genes including interferons. Frequent TP53 mutations in tumors with a higher load of L1 insertions suggest the critical role of TP53 in restricting retrotransposons as a guardian of L1 expression and cancer immunity.

A screen of 172 open reading frames (orfs), of unknown genetic function across several human viruses was designed to discover novel interactions with p53. The orfs encoded viral proteins, miRNA's and lncRNA's. The ORFEOME project was based on the hypothesis that every virus should encode some functions that interfere with the p53 signaling network. The methods present a broad net by screening for interactions without necessarily defining how interactions arise.

The DNA damage response (DDR) pathway stabilizes p53 leading to increased nuclear relocation, binding to p53 response elements, rearrangement of chromatin and transcription of p53 target genes. Any of the multiple p53 related interactions along the way is a potential target of translated viral proteins on the function of p53. 

p53 is also induced in response to viral infections as a downstream transcriptional target of type I interferon (IFN) signaling. Cells with functional p53 exhibited markedly decreased viral replication early after infection. This early inhibition of viral replication was mediated both in vitro and in vivo by a p53-dependent enhancement of IFN signaling by the induction of genes containing IFN-stimulated response elements. p53 also contributed to an increase in IFN release from infected cells. This p53-dependent enhancement of IFN signaling is dependent to a great extent on p53 activation and transcription of IFN regulatory factor 9, a central component of the IFN-stimulated gene factor 3 complex. Thus p53 contributes to innate immunity by enhancing IFN-dependent antiviral activity independent of its functions as a proapoptotic and tumor suppressor gene.

p53 likely cooperates with histone and DNA methylation to silence specific retroelements. In the zebrafish model, it was shown that p53-dependent H3K9me3 methylation, in the promoter region of a synthetic human LINE1 element mapped to a known p53-binding site. Some evidence in human cell lines suggests that p53 can physically interact with both H3K9 tri-methyltransferases and DNA methyltransferases. In basal stress-free conditions, unacetylated p53 is pre-bound to many target genes together with SET - a repressor protein, which mediates repression of p53 target genes. Additionally, p53 as a master regulator of transcription might regulate gene expression of key epigenetic or piRNA factors. 

Through L1's we get a sense of p53's interconnectedness to DNA damage, viral replication, cancer and immunity. In a way we can sympathize with it, especially when overloaded by viral infiltration and eruption. Its understandable how, under those conditions double stranded DNA breaks and pathway impediments compromise its ability to be guardian of the genome!

Natural Killers Linked to Overall Survival in Cancer

A meta analysis of tumor samples, collected between 1973 and 2016, in 53 studies confirmed overall survival (OS) correlated with Natural Killer cell infiltration into solid tumors. The number of NK cells infiltrating solid tumors, including those considered “highly ”infiltrated was relatively low, compared with other immune populations. Notwithstanding, the presence of a single NK cell, within a high powered microscopic field was associated with significantly improved OS and disease free survival in colorectal cancer, HER2 + breast cancer and hepatocellular carcinoma.

The finding supports the prospect that single tumor infiltrating NK cells, in a sampled tissue can be determinative for OS. By inference a single tumor infiltrating NK cell or cells possess characteristics that are relative to OS and beneficial to patient.  

NK cell surface receptors are densely varied defining at least 30,000 unique NK cell populations within each individual. NK cell classifications, relative to tumor infiltration and OS is enormously complex, especially at this scale and present definitions of activating and inhibiting receptor combinations underwhelm. To identify NK cells that have infiltrated or may be capable of infiltrating a patient tumor to improve OS we focused on biopsied tumor tissue selections whether or not they include NK cells.

Our work is with two tumor types in humanized mice. Multiple sections of each tumor were resected and divided into multiple parts for coculture with allogenic naïve, IL2 and probiotic enhanced NK cells and for DNA sequencing. After coculture NK cell cytotoxicity and other detailed measures resulting from each resected section and from single cells were assessed. Presently sequencing of DNA from each resected, divided section (pre-coculture) is focused on comparisons derived from TP53.

In the final stage NK cells will be cocultured with resected tumor tissue and will be made to challenge new tumor tissue and single cells, from the resected tumor from which the NK coculture was derived. The objective will be whether Codondex analysis of TP53 DNA sequencing can predict the most successful tumor tissue candidates based upon the most effective cocultured NK cell challenge to the tumor derived tissue or cells. 

If Codondex algorithm is found to identify a direct or indirect logic for tissue or cell selection that is effective in vitro our work will continue to next stage in vivo testing and analysis on similar grounds. 

  

 

p53 in Transition, Covid19, Cancer and Immunity

p53's trajectory, sensitivity and function influences different outcomes in stages of transition of developing pluripotent or embryonic stem cells that can inform tumorigenesis and immune response. 

Cell cycle arrest and apoptosis are not dependent on p53 prior to p53-dependent embryonic stem cell differentiation, and DNA damage-induced apoptosis was p53-independent. 

Human (induced) pluripotent stem cell differentiation, from endoderm toward mesoderm was driven by a DNA damage-induced, time-sensitive, p53 transcriptional program. In cells passing through epithelial-to-mesenchymal transition DNA damage prevents the normal reduction of p53 levels, diverting the transcriptional program toward mesoderm without induction of an apoptotic response. 

From the blastocyst, villous cytotrophoblasts undergo a partial epithelial to mesenchymal transition (EMT) when they differentiate into extravillous cytotrophoblasts and gain the capacity to migrate and invade. Extravillous cytotrophoblast invasion involves a cellular transition from an epithelial to mesenchymal phenotype. TWIST, an emerging gene of interest strongly influences p53 to complete EMT.  

p53 is necessary for cells to initiate EMT, but attenuation of its levels by MDM2 is also necessary for expression of the mesenchymal phenotype. Downregulation of p53 may be directly controlled by this transition as the EMT factor TWIST1 can bind p53 leading to its MDM2-dependent degradation. During definitive endoderm differentiation, downregulation of p53 may be necessary for the normal transcriptional program to proceed. The unscheduled stabilization of p53, caused by DNA damage may result in a transcriptional perturbation driving differentiation away from definitive endoderm.

Using KRAS-driven pancreas tumor-derived cancer cells as a model of p53 loss, p53 deletion can promote immune tolerance through the recruitment of both myeloid and Treg cells. Enrichment of these suppressive cell populations enhanced the protection of p53-null cancer cells from immune-mediated elimination. 

Tumor-derived VEGF through VEGFR2 and NRP-1 creates a perivascular niche to regulate the initiation and stemness of skin tumors and autocrine VEGF promotes survival and invasion of prostatic, pancreatic cancer and glioblastoma cells, particularly for cancer stem-like cells in a NRP-1-dpendent enhanced EMT manner. 

A recent SARS-CoV2 update may point to anti-apoptotic affects that occur through the axis inactivation of p53 and mitochondrial apoptotic pathway as mediated by NRP-1, in endothelial cells of Zebra Fish. Decreased levels of p53 might suppress caspase cleavage and therefore downregulate apoptosis (a feature of Covid19). Data showed that p53 is the downstream signaling molecule of PI3K/Akt pointing at MDM2 as a signaling component in NRP-1 survival signaling. NRP-1 was shown as a host factor for SARS-CoV-2 infection and in a successful Covid19 phase trial, for critical care patients injection of apoptotic cells induced signaling to restore immune homeostasis.  

Even brief reactivation of endogenous p53, in p53-deficient tumors can produce complete tumor regressions. Primary response to p53 reactivation was not apoptosis, but the induction of a cellular senescence program associated with differentiation and upregulation of inflammatory cytokines. 

Elimination of senescent tumors, by Natural Killer (NK) cells occurred as a result of signal cooperation associated with p53 expression or senescence, which regulate NK cell recruitment and other signals that induce NKG2D ligand expression on tumor cells. p53 expression enhances CCL2-dependent NK cell recruitment to the tumors.

A feature of several NK cell activating receptors resides in their capacity to detect self molecules induced in conditions of cellular stress. This is the case for NKG2D, which interacts with various ligands, including CCL2 that are expressed at low levels in most tissues but are overexpressed upon initiation of cellular distress, for example, after initiation of the DNA damage response.

Codondex is working to identify p53 status in cells isolated from TME tissue samples that can be cocultured to educate NK cells to stimulate a desired immune response.