All Roads Lead to (Ch)Romosome 19!

A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

A pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure. 

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

When Immunity Fails Programmed Cell Death

DNA Damage Response

Telomeric repeat (TR) sequences are responsible for genome integrity, where instability is a primary factor that leads to activation of p53. Introduction of a TR into cells leads to stabilization of p53, specific to TRs and not observed in plasmids containing non-TR sequences. TR-activated p53 exhibited enhanced transcriptional activity and induced p53-dependent growth suppression, measured as a reduction in colony formation. Sub-telomeric p53 binding prevents accumulation of DNA damage at human telomeres.  

Healthy cells experience thousands of DNA lesions per day. Micronuclei, containing broken fragments of DNA or chromosomes, that have become isolated, are recognized as one mediator of DNA damage response (DDR)-associated immune recognition. Like micronuclear DNA, mitochondrial DNA (mtDNA) is recognized by cGAS to drive STING-mediated inflammatory signaling. Mitochondrial damage can intersect DNA repair and inflammatory cascades with programmed cell death, through p53. In human fibroblasts and conditionally immortalized vascular smooth muscle cells p53 mediates CD54 (ICAM-1) overexpression in senescence.

Replicative senescence, an autophagy dependent program and crisis are anti-proliferative barriers that human cells must evade to gain immortality. Telomere-to-mitochondria signaling by ZBP1 mediates replicative crisis. Dysfunctional telomeres activate innate immune responses (IFN) through mitochondrial TR RNA (TERRA)–ZBP1 complexes. Senescence occurs when shortened telomeres elicit a p53 and RB dependent DNA-damage response. A crisis-associated isoform of ZBP1(innate immune sensor) is induced by the cGAS–STING DNA-sensing pathway, but reaches full activation only when associated with TERRA transcripts from dysfunctional telomeres. p53 utilizes the cGAS/STING innate immune system pathway for both cell intrinsic and cell extrinsic tumor suppressor activities. cGAS-STING activation induces the production of IFN-b and increases CD54 expression in  human cerebral microvascular endothelial cells.

In melanoma patients there is a significant correlation between cGAS expression levels and survival and between NK cell receptor expression levels and survival. Loss of cGAS expression by tumor cells could permit the tumor cell to circumvent senescence or prevent immunostimulatory NKG2D ligands expression. Loss of p53 and gain of oncogenic RAS exacerbated pro-malignant paracrine signaling activities of senescence-associated secretory phenotypes. Results imply that heterogeneity in cGAS activity, across tumors, could be an important predictor of cancer prognosis and response to treatment and suggest that NK cells could play an important role in mediating anti-tumor effects. Coculture of wild-type p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. 

When p53 consensus sequences are modified and DNA damage response is compromised, replicative crisis ensues, mitochondrial membranes misfunction, mtDNA expression is downregulated and IFN signaling upregulates. A cell may then express activating immune ligands that bind NK receptors signaling non-self and cytolytic death or inhibitory receptors that signal self and immortality. 

Indispensable Mitochondria - Cancers back door?

Immediately prior to fertilization spermatozoa are devoid of Mitochondrial DNA (mtDNA), potentially explaining an aspect about selection that may serve the legacy for maternal immune tolerance. Post fertilization, on day 11-13, outermost trophoblasts of the blastocyst dock with the decidual lining as it embeds in the uterine wall. Then, maternal vascular remodeling and placental formation begin toward successful implantation. 

Higher quality trophoblasts are associated with lower mtDNA content. Moreover, euploid blastocysts with higher mtDNA content had a lower chance to implant and mtDNA replication is strictly downregulated between fertilization and the implantation. What is it about absent or reduced mtDNA that may also relate to the mechanics of immune tolerance and vascular remodeling, which are also features of solid tumors.

The initial absence or downregulation of MtDNA, may relate an immune tolerance by uterine Natural Killer (NK) cells. As mtDNA upregulates, after day 12, it may initiate NK auto-reactivity required for maternal microvascular remodeling. This auto-immune paradox is a prerequisite for vascular remodeling, which is also seen in localized hypertension, and the likely basis of successful blastocyst implantation. Acutely, micro-hypertension induced mechanical stretch, on endothelial cells, interconnects innate and adaptive immune responses. 

The dominant cell in the decidua is an NK subset (dNK), they express low levels of IFN-γ and express proteins of Renin Angiotensin System (RAS). At day 12 RAS peptide ANP colocalizes to dNK’s suggesting that dNK RAS infers localized responsiveness.  When TFAM, required for transcription of mtDNA, was deleted from cardiomyocytes, after 32 days, animals developed cardiomyopathy and Nppa (gene encoding ANP) and Nppb expression was elevated. 

In monocytes increased endothelial stretch activates STAT3, which is involved in driving almost all pathways that control NK cytolytic activity and reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis. p53, Stat3, and, potentially, the estrogen receptor are thought to act as co-regulators, affecting mitochondrial gene expression through protein-protein interactions. Co-immunoprecipitation of p53 with TFAM suggests it may regulate mitochondrial DNA-damage repair.

Like initial trophoblasts with low level mtDNA, mature cells, like cardiomyocytes that prolong low level mtDNA may also aggravate autoimmune sponsored hypertension that remodels microvascular networks providing nutrients for growth of reduced mtDNA stem cell replicas. Indeed, mitochondrial dysfunction (from depleted mtDNA) does not affect pluripotent gene expression, but results in severe defects in lineage differentiation.

During severe sepsis, intense, on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. This may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. 

Identifying cells that optimally educate cocultured NK cells for precision IFN-γ and cytolytic responsiveness is part of the ongoing work by the Codondex team.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Educating Perfect Natural Killers

Mining Tissue Match for Immune Co-culture

Mutant p53 knockdown in KPC (pancreatic ductal adenocarcinoma) cells of immune deficient mice had no effect on primary tumor growth, by contrast the reduced tumor growth in the immune-proficient syngeneic host was due to altered immune cell recruitment.

In vivo, the increased production of pro-inflammatory cytokines coupled with increased Natural Killer (NK) cell ligand expression permits the recruitment of immune cells and clearance of abnormal cells. Elimination of senescent tumors by NK cells may occur as a result of the cooperation of signals associated with p53 expression or senescence, which regulate NK cell recruitment, and other signals that induce NKG2D ligand expression on tumor cells.

Coculture of wild-type (wt) p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. Taken together findings define the involvement of p53 in the regulation of specific NKG2D ligands that enhance NK cell–mediated target recognition.

Inhibitory KIR-educated NK cells showed significantly increased expression of the glucose transporter Glut1 in comparison to NKG2A-educated or uneducated NK cells, with and without exposure to target cells. Educated NK cells displayed significantly higher rates of cellular glycolysis than uneducated NK cells indicating they may reside in different metabolic states prior to activation. The ability to metabolize glucose may represent a mechanism for the superior functionality of educated NK cells expressing KIR receptors. 

Cancer cells acquire immunoediting abilities by which they evade surveillance and escape eradication. Murine p53 missense mutation G242A (human G245A) suppresses activation of host NK cells, enabling breast cancer cells to avoid immune assault. Serial injection of EMT6 breast cancer cells that carry wild-type (wt) Trp53 promoted NK activity, while SVTneg2 cells carrying Trp53 G242A+/+ mutation decreased NK cell numbers and increased CD8+ T lymphocyte numbers in spleen. Upon co-culture with isolated NK cells, EMT6 cells activated NK cells and proliferation, increasing interferon-gamma (IFN-γ) production; however, SVTneg2 cells suppressed NK cell activation. p53 can modulate expression by cancer cells of Mult-1 and H60a activating and inhibitory ligands for NKG2D receptors of NK cells, respectively, to enhance immune surveillance against cancer. p53 is requisite for NK cell-based immune recognition and elimination of cancerous cells, and p53 missense mutant in cancer cells impairs NK cell responses.

NK cells are the oldest member of the innate lymphoid cell family (ILC) and the only representative of cytotoxic ILCs. These tissue-resident innate immune cells have a similar functional diversity to T cells including lineage-specifying transcription factors that drive certain effector programs. ILCs are present in almost every tissue, but strongly enriched at barrier surfaces, where they regulate immunity to infection, chronic inflammation, and tissue maintenance. ILCs orchestrate tissue homeostasis through their ability to sustain bidirectional interactions with epithelial cells, neurons, stromal cells, adipocytes, and many other tissue-resident cells. ILCs provide an integrated view on how immune responses in tissues are synchronized with functional relevance far beyond the classical view of the role of the immune system in discrimination between self/non-self and host defense.

Codondex has evidenced p53 genetic variations, in multiple samples of same biopsy tissue from pancreatic tumors and oral squamous cell carcinoma's that may distinguish host tumor tissue gradients. The effect of highly-specific tissue-selected cell co-culture to educate ILC/NK cells may enhance the prospect for tissue penetration by these expanded, activated cytotoxic cells to improve overall survival.  

Immunity keeping p53 in check!

In a 2012 study on the topology of the human and mouse m6A RNA methylomes, Gene Ontology (GO) analysis of differentially expressed genes (DEG's) indicated a noteworthy enrichment of the p53 signaling pathway: 22/23 genes had differentially expressed splice variants, of which 18 were methylated. Moreover, 15 other members of the signaling pathway, which were not significant DEG's, exhibited significant differential isoform expressions. For example, isoforms of MDM4, needed for p53 inactivation were downregulated. Similar pro-apoptotic effects were observed in other pathway genes including MDM2, FAS and BAX. Higher apoptosis rate in HaCaT-T cells resulted with knockdown of m6A subunit METTL3, which also reversed a significant decrease in p53 activity. Modulation of p53 signaling through splicing may be relevant to induction of apoptosis by silencing of METTL3. 

Then, in 2019 a study of arsenite-induced human keratinocyte transformation demonstrated that knockdown of METTL3 significantly decreased m6A level, restored p53 activation and inhibited cellular transformation phenotypes in the-transformed cells. Further, m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A also upregulated expression of negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. Taken together, the study revealed the novel role of m6A in mediating human keratinocyte transformation by suppressing p53 activation and sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.

Finally in 2021 a discovery that YTHDF2 is upregulated in NK cells upon activation by cytokines, tumors, and cytomegalovirus infection. Ythdf2 deficiency in NK cells impaired its anti-tumor and anti-viral activity in vivo. YTHDF2 maintains NK cell homeostasis and terminal maturation, correlating with modulating NK cell trafficking and regulating Eomes, respectively. It promotes NK cell effector function and is required for IL-15-mediated NK cell survival and proliferation by forming a STAT5-YTHDF2 positive feedback loop. Analysis showed significant enrichment in cell cycle, division, and division-related processes, including mitotic cytokinesis, chromosome segregation, spindle, nucleosome, midbody, and chromosome. This data supports roles of YTHDF2 in regulating NK proliferation, survival, and effector functions. Transcriptome-wide screening identified Tardbp (TDP-43) to be involved in cell proliferation or survival as a YTHDF2-binding target in NK cells.

Downregulation of METTL3, which in spinal cord contributes with YTHDF2 to modulate inflammatory pain may upregulate differentially expressed p53 network splice variants that oppose YTHDF2 induced downregulation of p53, via PRDM2 leading to apoptotic or diseased cells. In diseased environments cytokines may upregulate YTHDF2 in NK cells leading to downregulation of p53 and cytoskeletal transformation that may be sufficient, at an immune synapse to advance cytolysis.

p53 signals may inform selections of cells and tissue that prime NK cells for advanced, personalized immune therapy. 

IFN-γ Concentration, p53 and Immune Sensitivity

IFN-γ 

Dimorphic complexity between Human Leukocyte Antigen (HLA) and Killer Immune Receptor (KIR) haplotypes introduce significant challenges for personalized Natural Killer (NK) and immune cell therapy. In vitro models support a p53 requirement for upregulation of NK ligands and there is a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma's (BCC) with a higher likelihood that KIR B carriers harbor abnormal p53. Data suggests that KIR encoded by B genes provides selective pressure for altered p53 in, at least BCC's. 

Breast cancer (BC) patients exhibit reduced NK-cytotoxicity in peripheral blood. To test whether certain KIR-HLA combinations impair NK-cytotoxicity that predispose to BC risk, KIR and HLA polymorphisms were analyzed in 162 women with BC and 278 controls. KIR-B genotypes increased significantly in BC. Certain activating KIR (aKIR) HLA ligand combinations were significantly increased in advanced-BC patients whose combinations also shared specific inhibitory KIR (iKIR) counterparts. Contrarily, iKIR-HLA pairs without their aKIR-HLA counterparts were significantly higher in controls. The data suggests NK cells expressing iKIR to cognate HLA-ligands in the absence of specific aKIR counterpart are instrumental in antitumor response. 

The TP53 family consists of three sets of transcription factor genes, TP53, TP63 and TP73, each expresses multiple RNA variants and protein isoforms. TP53 is mutated in 25-30% of BC's, but the effect of isoforms in BC is unknown. Predicted changes in expression of a subset of RNAs involved in IFN-γ signaling were confirmed in vitro. Data showed that different members of the TP53 family can drive transcription of genes involved in IFN-γ signaling in different BC subgroups. Moreover, tumors with low IFN-γ signaling were associated with significantly poorer patient outcome.

NK receptor NKG2D interacts with several virus or stress inducible ligands, including ULBP1 (NKG2DL1) and -2 expressed on target cells. Induction of wild-type p53, but not mutant p53, strongly upregulated mRNA and surface expression of ULBP1 and -2, but not other ligands. An intronic p53-responsive element was discovered in these genes. Coculture of wild-type, p53-induced human tumor cells with primary human NK cells enhanced NKG2D dependent degranulation and IFN-γ production by NK cells.  

In the Tumor Micro Environment (TME) IFN-γ is produced at various concentrations in response to numerous immune stimulants and highlights the need for more personalized, disease centric approach. Engagement of IFN-γ Receptor on distinct tumor stromal cells, induction of interferon stimulated genes, immune status of the TME, and IFN-γ concentration are recognized as critical determinants for IFN-γ-mediated outcomes. Notably, an appropriate antitumor concentration of IFN-γ has yet to be determined. Interestingly IFN-γ produced by NK cells is said to be an essential mediator of Angiotensin II inflammation and vascular dysfunction.

Pharmacological activation of p53 exerts a potent antileukemia effect on antitumor immunity, including NK cell-mediated cytotoxicity against acute myeloid leukemia (AML). Interestingly, orally administered DS-5272 (a potent inhibitor of MDM2 - promotor of p53 degradation) induced upregulation of CD107a and IFN-γ in NK cells but not in CD8+ T cells. Furthermore, coculture of NK cells with leukemia cells resulted in massive apoptosis. 

Findings strongly suggest an interaction between B7 (NK receptor) molecules contribute to a particular design of the inflammatory microenvironment including B7-H6 and PD-L1, for which therapy was enhanced by expanded NK autologous or donor cells. RNA transfections, into HeLa cells of p53 or BRCA1 intron1 Key Sequences (based on Codondex iScore's most significant mRNA-intron1 variations) caused several genes to be upregulated, +1500% above control including B7-H6 (NCR3LG1) ligand for NCR3 (Nkp30) NK cell receptor which, when engaged triggers IFN-γ release. NCR3 and soluble isoforms of Leukocyte Specific Transcript 1 may play a role in inflammatory and infectious diseases. 

Blockade of B7-H3 prolonged the survival of SKOV3 ovarian cancer cell, an in ovarian tumor-bearing mice, miR-29c improved the anti-tumor efficacy of NK-cell by directly targeting B7-H3. miR-29c downregulates B7-H3 and inhibits NK-cell exhaustion. Low levels of mir-29c have been associated with mutated p53 in BC patients. miR-29 miRNAs activate p53 by targeting p85α and CDC42 and upregulate p53 levels that induce apoptosis in a p53-dependent manner. miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting IFN-γ. 

Besides (intron predominant) human ALU repeats, reverse complementary sequences between introns bracketing circRNAs are highly enriched in RNA editing or hyper-editing events. Knockdown of double stranded RNA-editing enzyme - ADAR1 significantly and specifically upregulated circRNA expression. In its absence (interferon stimulating) oligoadenylate synthetase (OAS) can be activated by self-dsRNA (in contrast to viral dsRNA), resulting in RNase L activity and cell death. Conversely, OASL1 expression enhanced RIG-I-mediated IFN induction. In cells absent of p53, immunogenic, endogenous mitochondrial dsRNA are produced and processed by the OAS/RNase L system presenting a novel mechanism in diseases with aberrant immune responses. IFN-γ restores the impaired function of RNase L and induces mitochondria-mediated apoptosis in lung cancer. The p53—OAS axis, in mitochondrial RNA processing may prevent self-nucleic acid such as dsRNA from aberrantly activating innate immune responses.

A plethora of evidence supports bottom up approach to personalized therapy. A p53 intron1-mRNA regulatory loop, as a potential mechanism in IFN responses to infection and disease may be diagnostic. Pre-clinical research, presently underway will establish whether p53 is diagnostic for specific selections of a biopsy to educate NK cells and trigger effective immune response.