Tuesday, October 29, 2024

Pathogens And Immunity - Mutual Memories


The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 


Sunday, October 27, 2024

Keep Your TP53 Cool!


Ancestral functions of p53 operate through conserved mechanisms to contain DNA retrotransposons, which are large genomic regions containing repeat sequences. L1 are a class of transposable DNA elements found in 17% of the genome that are evolutionarily associated with primitive viral origins. Around 100 have retained the ability to retro-transpose. Findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility.

HSATII and intact L1 are under selection to maintain CpG motifs, and specific Alu repeat families likewise maintain the proximal presence of inverted repeats to form double-stranded RNA (dsRNA).  This demonstrated that viral mimicry is a general evolutionary mechanism whereby genomes co-opt pathogen-associated features, generated by prone repetitive sequences, likely offering an advantage as a quality control system against transcriptional dysregulation. For multicellular organisms with a high degree of epigenetic regulation, a repeat species with a non-immune function may be co-opted, maintaining stimulatory features that release a danger signal when epigenetic control is lost, such as during the release of repeats after p53 mutations, where immunostimulatory repeats may provide a back-up for p53 functions such as senescence.

Further, torsional flexibility of DNA at certain p53 response elements (RE's) is a significant factor that stages early to late binding of p53 to RE's and has been shown to determine the order and outcome of gene signaling in response to stress and other cellular conditions. This staging prioritizes the initial steps of p53-dependent target-gene expressions, thereby contributing to survival versus death decisions in the p53 system. The mechanism of joint regulation through half-sites is also relevant to transcription and expands the number of genes that may be directly controlled in master regulatory networks.

This was demonstrated through the flexibility of ~200 p53 REs and functional outcomes of p53-target gene activations. Genes belonging to pathways that were activated rapidly upon stress contain p53 REs that have significantly more torsional flexibility relative to p53 REs of genes involved in pathways that are activated later in the response to stress. 

RE binding can also be impacted by way of the following example. A single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor gene (FLT1) generates a half-site p53 response element (RE) that results in p53 responsiveness of the promoter. Transcriptional regulation required an Estrogen Receptor half site response element (ERE) 225 nucleotides upstream.

RE regulation is also evident in the GCGTG core AhR RE invoked by Dioxin. From 48 sequenced samples of two different tumors, Codondex identified 9 unique Key Sequences (KS) of the TP53 Consensus that contained the core AhR 5′-GCGTG-3′ binding sequence, including some that overlapped p53 RE quarter binding sites (underlined) as illustrated below;

(TP53 intron1) GGATAGGAGTTCCAGACCAGCGTGGCCA   TP53 [1706,1710], AhR [1699,1726]

(TP53 intron1) AAAAATTAGCTGGGCGTGGTGGGTGCCT  AhR [1760,1787], TP53 [1783,1787]

Subject to the torsional staging at p53 RE's the implication is that nuclear relocation of AhR, by dioxins, to bind AhR RE's may also influence TP53 transcription especially at overlapping or proximal p53 RE's. p53 binding the TP53 promoter can also invoke an autoregulation that, in addition to torsional flexibility, is also sensitive to dosage and autoregulation at the TP53 P2 internal promoter. 

Under normal conditions TP53 is infrequently translated and p53 levels remain in steady state, but Under certain epigenetic conditions auto and other forms of  p53 regulation begin to impact its massive regulatory network widely affecting cellular function. p53 can also autoregulate transcription while Tp53 is being transcribed. In these situations TP53 could open to p53 binding because of the active cycle of p53 translation (subject to its degradation and with positive nucleation signals) at particular RE's. 

These conserved mechanisms to restrain retrotransposons and order p53's binding priority at RE's provide insight to the refined nature of gene stability and transcription. However, gene transcription is often imperfect in co-operation or competition with other nearby genes and proteins that affect predicted outcomes.