Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Short Sequences of Proximally Disordered DNA

Oxford Nanopore Device Reducing Sequencing Cost

Relationships exist between short sequences of proximal DNA (SSPD) of a gene that when transcribed into RNA present stronger or weaker binding attractions to RNA binding proteins (RBP'S) that settle, edit, splice and resolve messenger RNA (mRNA). Responsive to epigenetic stimuli on Histones and DNA, mRNA are constantly transcribed in different quantity, at different times such that different mRNA strands are transported from the nucleus to cytoplasm where they are translated into and produce any of more than 30,000 different proteins.

Single nucleotide polymorphisms and DNA mutations can alter SSPD combinations in different diseased cells thus altering sequence proximity, ordering that affects transcribed RNA's attraction and optimal binding of RBP's. This may result in modified splicing of RNA, assembly of mRNA and slight or major variations in some or all translated protein derived from that gene. 

The specific effects of these DNA variations, on the multitude of proteins produced are generally unknown. However, it remains important to understand their effects in disease, diagnosis and therapy. Typically these have historically been researched by large scale analysis of RBP on RNA as opposed to the more fundamental, yet underrepresented massive array of diseased variant DNA to mRNA transitions.

Most pharmaceutical research is directed to a molecular interference targeting an aberrant protein to cure widely represented or highly impactful disease conditions of society. Economic assessments generally influence government decisions to support research based on loss of GDP contribution by a specific disease in a  patient cohort. However, in the modern multi-omics era top down research into protein-RNA activity is descending deeper into the cell to include RNA-mRNA and mRNA-DNA customizable therapies that will eventually resolve individually assessed diseases at a price that addresses much larger array of patient needs.  

SNP's and other mutations can vary considerably in cells. These variations can cause instability during division and lead to translated differences that can ultimately drive cancerous cell growth to escape patient immunity. Like a 'whack-a-mole' game, pattern variation and mechanistic persistence eventually beat the player. Without effective immune clearance these cells can replicate into tumors and contribute to microenvironments that support their existence.

Link to video on tumor microenvironment https://youtu.be/Z9H2utcnBic

We thought to analyze DNA and mRNA transcripts from cells in tumors and their microenvironments to see if we could expose the SSPD disordered combinations that may have promoted sub-optimal RBP attractions and led to sustained immune escape. Given the complexity of DNA to mRNA transcription, for any given gene many distortions in gene data sets have to be filtered. To do that we focused on p53, the most mutated gene in cancer. We designed a method to compare sequences arrays of DNA and mRNA Ensembl transcripts, from the consensus of healthy patients to multiple cell samples extracted from different sections of a patients tumor and tumor microenvironment.     

We previously identified and measured different levels of Natural Killer (NK) cell cytotoxicity, produced from cocultures with the extracted samples of each of the multiple sites of a biopsy. We will measure the different p53 transcript SSPD combinations associated with each sample and determine whether disordered SSPD's corelate with NK cytotoxicity from each coculture. We expect to identify whether biopsied tumor cells, ranked by SSPD's predict the cytotoxicity resulting from NK cell cocultures. We will narrow our research to identify the varied expressions of receptor combinations associated with degrees of cytotoxicity. We will test immune efficacy to lyse and destroy tumor cells. Finally we will test for adaptive immune response. 

Our vision is for per-patient, predictable cell co-culture pairings, for innate immune cell education based on ranking DNA-mRNA combinations to lead to multiple effective therapies. The falling cost of sequencing and sophistication of GMP laboratories presently servicing oncologists may support a successful use of this analytical approach to laboratory assisted disease management.

   

 

IFN-γ Concentration, p53 and Immune Sensitivity

IFN-γ 

Dimorphic complexity between Human Leukocyte Antigen (HLA) and Killer Immune Receptor (KIR) haplotypes introduce significant challenges for personalized Natural Killer (NK) and immune cell therapy. In vitro models support a p53 requirement for upregulation of NK ligands and there is a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma's (BCC) with a higher likelihood that KIR B carriers harbor abnormal p53. Data suggests that KIR encoded by B genes provides selective pressure for altered p53 in, at least BCC's. 

Breast cancer (BC) patients exhibit reduced NK-cytotoxicity in peripheral blood. To test whether certain KIR-HLA combinations impair NK-cytotoxicity that predispose to BC risk, KIR and HLA polymorphisms were analyzed in 162 women with BC and 278 controls. KIR-B genotypes increased significantly in BC. Certain activating KIR (aKIR) HLA ligand combinations were significantly increased in advanced-BC patients whose combinations also shared specific inhibitory KIR (iKIR) counterparts. Contrarily, iKIR-HLA pairs without their aKIR-HLA counterparts were significantly higher in controls. The data suggests NK cells expressing iKIR to cognate HLA-ligands in the absence of specific aKIR counterpart are instrumental in antitumor response. 

The TP53 family consists of three sets of transcription factor genes, TP53, TP63 and TP73, each expresses multiple RNA variants and protein isoforms. TP53 is mutated in 25-30% of BC's, but the effect of isoforms in BC is unknown. Predicted changes in expression of a subset of RNAs involved in IFN-γ signaling were confirmed in vitro. Data showed that different members of the TP53 family can drive transcription of genes involved in IFN-γ signaling in different BC subgroups. Moreover, tumors with low IFN-γ signaling were associated with significantly poorer patient outcome.

NK receptor NKG2D interacts with several virus or stress inducible ligands, including ULBP1 (NKG2DL1) and -2 expressed on target cells. Induction of wild-type p53, but not mutant p53, strongly upregulated mRNA and surface expression of ULBP1 and -2, but not other ligands. An intronic p53-responsive element was discovered in these genes. Coculture of wild-type, p53-induced human tumor cells with primary human NK cells enhanced NKG2D dependent degranulation and IFN-γ production by NK cells.  

In the Tumor Micro Environment (TME) IFN-γ is produced at various concentrations in response to numerous immune stimulants and highlights the need for more personalized, disease centric approach. Engagement of IFN-γ Receptor on distinct tumor stromal cells, induction of interferon stimulated genes, immune status of the TME, and IFN-γ concentration are recognized as critical determinants for IFN-γ-mediated outcomes. Notably, an appropriate antitumor concentration of IFN-γ has yet to be determined. Interestingly IFN-γ produced by NK cells is said to be an essential mediator of Angiotensin II inflammation and vascular dysfunction.

Pharmacological activation of p53 exerts a potent antileukemia effect on antitumor immunity, including NK cell-mediated cytotoxicity against acute myeloid leukemia (AML). Interestingly, orally administered DS-5272 (a potent inhibitor of MDM2 - promotor of p53 degradation) induced upregulation of CD107a and IFN-γ in NK cells but not in CD8+ T cells. Furthermore, coculture of NK cells with leukemia cells resulted in massive apoptosis. 

Findings strongly suggest an interaction between B7 (NK receptor) molecules contribute to a particular design of the inflammatory microenvironment including B7-H6 and PD-L1, for which therapy was enhanced by expanded NK autologous or donor cells. RNA transfections, into HeLa cells of p53 or BRCA1 intron1 Key Sequences (based on Codondex iScore's most significant mRNA-intron1 variations) caused several genes to be upregulated, +1500% above control including B7-H6 (NCR3LG1) ligand for NCR3 (Nkp30) NK cell receptor which, when engaged triggers IFN-γ release. NCR3 and soluble isoforms of Leukocyte Specific Transcript 1 may play a role in inflammatory and infectious diseases. 

Blockade of B7-H3 prolonged the survival of SKOV3 ovarian cancer cell, an in ovarian tumor-bearing mice, miR-29c improved the anti-tumor efficacy of NK-cell by directly targeting B7-H3. miR-29c downregulates B7-H3 and inhibits NK-cell exhaustion. Low levels of mir-29c have been associated with mutated p53 in BC patients. miR-29 miRNAs activate p53 by targeting p85α and CDC42 and upregulate p53 levels that induce apoptosis in a p53-dependent manner. miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting IFN-γ. 

Besides (intron predominant) human ALU repeats, reverse complementary sequences between introns bracketing circRNAs are highly enriched in RNA editing or hyper-editing events. Knockdown of double stranded RNA-editing enzyme - ADAR1 significantly and specifically upregulated circRNA expression. In its absence (interferon stimulating) oligoadenylate synthetase (OAS) can be activated by self-dsRNA (in contrast to viral dsRNA), resulting in RNase L activity and cell death. Conversely, OASL1 expression enhanced RIG-I-mediated IFN induction. In cells absent of p53, immunogenic, endogenous mitochondrial dsRNA are produced and processed by the OAS/RNase L system presenting a novel mechanism in diseases with aberrant immune responses. IFN-γ restores the impaired function of RNase L and induces mitochondria-mediated apoptosis in lung cancer. The p53—OAS axis, in mitochondrial RNA processing may prevent self-nucleic acid such as dsRNA from aberrantly activating innate immune responses.

A plethora of evidence supports bottom up approach to personalized therapy. A p53 intron1-mRNA regulatory loop, as a potential mechanism in IFN responses to infection and disease may be diagnostic. Pre-clinical research, presently underway will establish whether p53 is diagnostic for specific selections of a biopsy to educate NK cells and trigger effective immune response.

Custom Immunotherapy To Address Dimorphic Complexities.

Dimorphic relationships between genes on Chromosome (Chr)6, encoding Human Leukocyte Antigens (HLA) and those on Chr19, encoding Killer-cell immunoglobulin-like receptors (KIRs) may eventually uncover important information as to how, why and when Natural Killer (NK) cells determine self restraint or attack cells infected by pathogens and disease. These proteins emerge from their respective zones, on each chromosome that have and continue to be subject to frequent recombination events.

The active region of Chr19 has a long history of recombinations that have and continue to define the expression patterns of telomeric and centromeric proportions of KIR gene's encoding receptors that bind cells presenting MHC class 1, HLA haplotype combinations that vary significantly across tissues in different population groups. Adding complexity, HLA genes on Chr6 are also subject to significant recombination making the dimorphic functional HLA-KIR interactions difficult to predict. 

Studies across population groups reveal the great diversity of HLA-KIR dimorphisms. The Southern Han centromeric KIR region encodes strong, conserved, inhibitory HLA-C-specific receptors, and the telomeric region provides a high number and diversity of inhibitory HLA-A and -B-specific receptors. In all these characteristics, the Chinese Southern Han represent other East Asians, whose NK cell repertoires are thus enhanced in quantity, diversity, and effector strength, likely augmenting resistance to endemic viral infections.

One study goes much further suggesting that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered p53 in BCC tumors. This preference implicates multi-modal p53 mechanisms that are also known to upregulate NK ligands, induce HLA-A11 assembly against Epstein Bar Virus and bind a frequently mutated p53 peptide in a complex with HLA-A and presented at the cell surface that prevent T-Cell response. In support, selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

In addition to KIR, adaptive NKG2C+ NK cells display fine peptide specificity selectively to recognize HCMV strains that differed by a single substitution in the HLA-E-binding UL40-derived peptide during infection. Distinct peptides controlled the degree of proliferation in synergy with pro-inflammatory cytokines. Viral peptides are known to augment inhibition at NKG2A. Conversely, NKG2A+ NK cells sense MHC class I downregulation more efficiently than KIRs. Thus, both receptor:ligand systems appear to have complementary functions in recognizing changes in MHC class I.

Polymorphic landscapes across HLA, KIR and NKG receptor repertoires coupled with receptor:ligand haplotype cross referencing makes it near impossible to predict therapeutic targets across the breadth of disease and disease combinations that affect populations. A recent KIR-HLA co-existence study of haplotypes in Breast Cancer patients and controls highlights this complexity. 

Genetic signatures that target discovery of desired cell functionality to select preferential cells/tissues from micro environments used to educate and license autologous or allogeneic NK cells may tease specific, finely tuned, intact receptor repertoires. Once licensing efficacy is reached, expanding NK cell populations and applying them to act upon previously unrecognizable cells of a patient becomes the next frontier of immune therapy. This is the exciting work presently being undertaken by researchers and staff working with Precision Autology using Codondex methodologies. 

p53 in Transition, Covid19, Cancer and Immunity

p53's trajectory, sensitivity and function influences different outcomes in stages of transition of developing pluripotent or embryonic stem cells that can inform tumorigenesis and immune response. 

Cell cycle arrest and apoptosis are not dependent on p53 prior to p53-dependent embryonic stem cell differentiation, and DNA damage-induced apoptosis was p53-independent. 

Human (induced) pluripotent stem cell differentiation, from endoderm toward mesoderm was driven by a DNA damage-induced, time-sensitive, p53 transcriptional program. In cells passing through epithelial-to-mesenchymal transition DNA damage prevents the normal reduction of p53 levels, diverting the transcriptional program toward mesoderm without induction of an apoptotic response. 

From the blastocyst, villous cytotrophoblasts undergo a partial epithelial to mesenchymal transition (EMT) when they differentiate into extravillous cytotrophoblasts and gain the capacity to migrate and invade. Extravillous cytotrophoblast invasion involves a cellular transition from an epithelial to mesenchymal phenotype. TWIST, an emerging gene of interest strongly influences p53 to complete EMT.  

p53 is necessary for cells to initiate EMT, but attenuation of its levels by MDM2 is also necessary for expression of the mesenchymal phenotype. Downregulation of p53 may be directly controlled by this transition as the EMT factor TWIST1 can bind p53 leading to its MDM2-dependent degradation. During definitive endoderm differentiation, downregulation of p53 may be necessary for the normal transcriptional program to proceed. The unscheduled stabilization of p53, caused by DNA damage may result in a transcriptional perturbation driving differentiation away from definitive endoderm.

Using KRAS-driven pancreas tumor-derived cancer cells as a model of p53 loss, p53 deletion can promote immune tolerance through the recruitment of both myeloid and Treg cells. Enrichment of these suppressive cell populations enhanced the protection of p53-null cancer cells from immune-mediated elimination. 

Tumor-derived VEGF through VEGFR2 and NRP-1 creates a perivascular niche to regulate the initiation and stemness of skin tumors and autocrine VEGF promotes survival and invasion of prostatic, pancreatic cancer and glioblastoma cells, particularly for cancer stem-like cells in a NRP-1-dpendent enhanced EMT manner. 

A recent SARS-CoV2 update may point to anti-apoptotic affects that occur through the axis inactivation of p53 and mitochondrial apoptotic pathway as mediated by NRP-1, in endothelial cells of Zebra Fish. Decreased levels of p53 might suppress caspase cleavage and therefore downregulate apoptosis (a feature of Covid19). Data showed that p53 is the downstream signaling molecule of PI3K/Akt pointing at MDM2 as a signaling component in NRP-1 survival signaling. NRP-1 was shown as a host factor for SARS-CoV-2 infection and in a successful Covid19 phase trial, for critical care patients injection of apoptotic cells induced signaling to restore immune homeostasis.  

Even brief reactivation of endogenous p53, in p53-deficient tumors can produce complete tumor regressions. Primary response to p53 reactivation was not apoptosis, but the induction of a cellular senescence program associated with differentiation and upregulation of inflammatory cytokines. 

Elimination of senescent tumors, by Natural Killer (NK) cells occurred as a result of signal cooperation associated with p53 expression or senescence, which regulate NK cell recruitment and other signals that induce NKG2D ligand expression on tumor cells. p53 expression enhances CCL2-dependent NK cell recruitment to the tumors.

A feature of several NK cell activating receptors resides in their capacity to detect self molecules induced in conditions of cellular stress. This is the case for NKG2D, which interacts with various ligands, including CCL2 that are expressed at low levels in most tissues but are overexpressed upon initiation of cellular distress, for example, after initiation of the DNA damage response.

Codondex is working to identify p53 status in cells isolated from TME tissue samples that can be cocultured to educate NK cells to stimulate a desired immune response. 

$100,000 Biohunt

Some of the past research on neoantigen and p53 antibodies in immunity has been encouraging. The data is enormously complex, but keeps pointing to TP53's great potential. To this end, we were anxious to start our mega-experiment, but were delayed by C19, now I'm glad to report we are well underway. In co-operation with researchers at UCLA we aim to determine whether Codondex transcript analysis, of TP53 can predict the best tumor tissue selection for most effective Natural Killer (NK) cell priming, activation and cell killing, including in autologous tumor micro environments.

We're hoping to to achieve a result along the path toward our ambitious clinical goal. We aim to prove that a specifically selected section from biopsied tissue can be used to effectively prime autologus NK cells for patient reapplication and disease treatment. 

This co-culture vs. sequencing challenge uses sections (T1-T8) taken from each of two tumors. Each section is co-cultured with 2 treated NK cell and one naive NK cell line and tests the efficacy of NK cell cytotoxicity against tumor cell and tumor tissue in killing assays. Separately, by sequencing TP53 of each selection and computing Codondex iScore(TM) algorithm we hope to identify specific features of each tissue selection that point computed results to research outcomes.

Co-culture vs. Sequencing Challenge

To better understand the analysis and encourage research contributions we are inviting applicants for first grants directed toward this objective. 

Codondex tools analyse genetic sequences at an arbitrary number of nucleotides. The tool provides an easy way to observe fine repetitive details of small subsequences contained within a gene. We compute various metrics for each subsequence including 'Inclusiveness', which measures the total occurrences of every computed smaller subsequence is found within the subsequence of interest. 

Our primary interest is intronic, non-coding DNA in multi-transcript genes. In these systems we create a transcript list, which we call the Vector, that is sorted by Codondex i-Score. This metric looks at Inclusiveness scaled by the length of the subsequence, to better account for intrinsic probability of finding smaller subsequences within progressively longer ones. Using this we look at the way order of this vector changes from subsequence to subsequence. Large changes in these vectors then prompts us to tag them for further investigation as it represents large deviation from transcript similarity, with this subsequence being labelled a Key Sequence. 

Codondex is proposing 3 grants for open problems to aid in our journey towards a more biologically useful platform. These 3 problems span statistical analysis, data acquisition and biological relevance of various aspects that are integral to our platform. 

Applicants should inquire further and sign up here.

What does COVID-19 have to do with heart attack?

Ground Glass Opacity's in Lungs

Natural Killer (NK) cells are depleted, but neutrophils are elevated in the lungs of hospitalized Coronavirus patients the world over. This is the sign of immune system chaos that typically precedes disease progression. How COVID-19 generates this condition is unknown, but surviving NK cells express NKG2A inhibitory receptors and are exhausted.

Typically patient CT scans reveal "Ground Glass Opacity's", fuzzy areas in lung scans that identify affected tissues. Without recovery at this point, the disease advances, tissues of the lungs can become infected, pneumonia may set it and soon after the patient may die.

It was recently published by doctors at Northwestern and UCLA that in around 20% of COVID-19 cases Troponin enzyme was elevated and correlated with very high mortality rates. Troponin is almost exclusively expressed in heart attack patients, so what does it have to do with COVID-19?

A different study tracked NK cells in lungs and linked pulmonary inflammation with depleted NK cells and elevated neutrophils. It found pulmonary NK cells control neutrophil intravascular motility and response to acute inflammation. Intriguingly, in a model of experimental myocardial infarction, NK cell depletion resulted in increased neutrophilic pathology in the lungs of mice, raising the question of how this influence is mediated. The study failed to identify the function of Ly6G, which by June 2019 remained unclear to the scientists what role it might play in the transfer of information between NK cells and neutrophils. A different team recently published a joint report showing lymphocyte antigen 6 family member E (Ly6E) impaired Coronavirus fusion and conferred immune control of viral disease. The link to Ly6 in these different reports may be important to front-line teams working to identify treatments.

In 2013 a joint China-Japan team had already published; "Lung Natural Killer Cells Play a Major Counter-Regulatory Role in Pulmonary Vascular Hyperpermeability After Myocardial Infarction". The report documented the counter-intuitive action of NK cells in lungs of mice induced with heart attack. Similarities to the reported behavior of NK cells and neutrophils in late stage COVID-19 patients expressing Troponin is remarkable. The team rescued the respiratory phenotype in NK cell–depleted mice by the adoptive transfer of NK cells from wild-type mice, but not from IL-10 knockout mice. All this may explain why preliminary successes have been achieved treating patients with plasma transfers or from patients who had recovered from Corona or with Mesenchymal stem cells.

Ly6 is only present in mice, but human neutrophils express the structurally related Ly6G molecule CD177 (19q13.31), a member of the Ly6/uPAR (urokinase plasminogen activator receptor) family. Interestingly, antibodies against CD177 have been shown to inhibit neutrophil transmigration across an endothelial monolayer, potentially by interfering with an interaction between Ly6G and PECAM1.

One interesting approach, at the right dosage may be to deploy a broad anti-venom aimed at 3TFx toxins because of their close resemblance to COVID-19 and Ly6 protein structures especially at the S1-CTD contact point. If anti-venom performs anywhere close to COVID-19 binding or connector domains it may impede it's entry to cells.

HCoV binding ACE2

A scientific conflict is brewing over the use ACE receptor inhibitor Captoptril against COVID-19 binding ACE. The drug is an angiotensin-converting-enzyme inhibitor derived from a peptide discovered in the venom of the lancehead viper (Bothrops jararaca). This debate over ACE2 upregulation may be preventing its broader use in patients despite its potential to reduce the capacity of COVID-19 to bind cells.

Its well known that several toxins and venoms can also lead to heart muscle injury, which COVID-19 seems to be emulating. The combination of viral immune response and false toxin signalling, that raises Troponin levels seems sufficient to trigger the immune system chaos that precedes typical disease progression and self-induced (possibly autoimmune) infection.

Impotent Natural Killers by Cancer Stem Cells and Ageing

Cancer stem cells have been found, through various mechanisms to alter the sentinel function and innate, immune surveillance of Natural Killer cells (NK). In senescent cells that have stopped cell division, including in cancer stem cell niches and NK induced vascular remodeling (as found in the developing placenta) NK's sentinel vigilance is also reduced.

Senescence-associated mitochondrial dysfunction, a significant trigger of multiple dimensions of the senescent phenotype is caused by disruption of normal mitochondrial autophagy (mitophagy). Mitophagy increases with aging and this age-dependent rise is abrogated by PINK1 or parkin deficiency. Deletion of a p53 response element on PINK1 promoter impacts p53-mediated PINK1 transcriptional repression. This p53-mediated negative regulation of autophagy has been found to be PINK1-dependent and constitutes a p53-PINK1 loop in nucleus and cytoplasm.

Further, mitophagy controls the activities of tumor suppressor p53 to regulate, at least hepatic cancer stem cells via Nanog. Prostate cancer cells escape NK attack by Nanog down-regulating ICAM1 (LFA1), to which NK would normally bind its target. In lung cancer NK have been found to limit the efficient clearance of senescent tumor cells from the mouse lung after p53 restoration. This indicated p53 may promote conditions for cellular survival and NK induced vascular remodeling or angiogenesis, necessary for the growth of tumors.

When under stress and inner mitochondrial membrane pressure gradient moves toward depolarization, Pink1 slots into the membrane, binds and phosphorylates p53 at Serine 392 (p53s392) and aids phagophore formation to enhance mitophagy. Mitophagy traps cytoplasmic p53s392, which reduces its transport to the nucleus where it would otherwise disrupt transcription of Nanog. (As illustrated below). 

Activated p53s392 nucleoside concentrations are effected by mitophagy

On the other hand, the sentinel function of NK may be subject to this PINK1 mediated mitochondrial switch. In prostate cancer cells Nanog promoted ICAM1 transcription required for NK binding target and cell killing. In prostate cancer cells Nanog over-expression restricts ICAM1, which promotes tumor formation. (As illustrated below). Investigating further, the direct functional link between p53 and ICAM-1 (CD54) in senescence and age-related disorders appears to be deeply integrated in mitophagy, senescence and immunity.

Nanog over-expression appears to be deterministic 

In stem cells where normal expression of Nanog transcribes ICAM1 and cancer stem cells where over-expression of Nanog restricts ICAM1, the variable PINK1-p53 switch may represent a "canary" that signals the state of  mitochondrial health to sentinel NK. However in some cancer cells where normal mitophagy is impaired and Nanog expression is restricted by p53s392, other p53 isoforms may directly promote the transcription of ICAM1.

In  two manipulation experiments using five different fibroblast cell lines that accelerated development of senescent associated secretory phenotypes a striking result was observed: oncogenic RAS expression, which causes genotoxic stress and senescence in normal cells, and functional loss of the p53 tumor suppressor protein. Both loss of p53 and gain of oncogenic RAS also exacerbated pro-malignant paracrine signaling activities. Experiments show that PINK1 and Parkin, which are regulated by p53 specifically regulate mitochondrial antigen presentation of both MHC classes.

So, the question is whether the p53-PINK1 mitochondrial switch acts as cell-health "canary" for sentinel NK, where its inherent variables and regulatory loop may be fertile ground for the challenges of developing cancers? 

Therapeutic Coding and non-Coding DNA Relationships

Relationships of coding and non-coding intra-gene DNA are good cause for intense research and scientific debate. Many cellular functions of non coding DNA have been discovered in the past 30 years, but prior to that these genomic regions were mostly considered 'junk'.

Probing relationships between a genes' protein coding, cDNA and at least one non-coding DNA section of the transcript, which in our work is intron1 can yield important data about genomic features in the combination. Over the past 7 years we focused on interrogating combination relationships, across multiple transcripts to construct intra-gene DNA signatures from apparently disparate DNA elements that are known to perform vastly different biological functions, yet are proximal and often adjacent.

First we considered codon to amino acid coding may operate a little different to the classical view if reading a first and second nucleotide made the third deterministic. This method would not alter the outcome of known protein coding, but it may alter the way we consider combination relationships between nucleotide's. For a transcript, any given length of cDNA and its respective intron1 sequence could possess undiscovered intrinsic order. In a model where order was tightly honored, transcript relativity may identify cDNA sequences that caused significant change in the order at each next nucleotide step.

To investigate transcripts, from the first nucleotide we computed every length cDNA k-mer. We associated k-mer's, of every possible length with the cDNA transcripts intron1 signature. Then, for a set of multiple same gene transcripts, in nucleotide order our algorithm ordered the transcripts into a vector based on their respective cDNA-kmer:intron1-signatures. Stepping through from one k-mer to the next we observed whether next k-mer significantly changed the order of transcripts in the vector. After filtering domino effects we ranked k-mers with the most significantly changed transcript order from the previous k-mer.  

Size of  circle 'K' in the example indicates k-mer length, but we only compare same length K

In the above example, it is evident that k-mer2 vs k-mer3 was the most changed because all three transcript positions moved without a domino effect. From the vector we identify intra:inter transcript conditions in next nucleotide relationships as represented in the k-mers. 

As an example, in our work with 15 viable consensus transcripts for p53 occasionally all 15 transcripts in the vector changed positions at the next k-mer. These intra transcript k-mer relationships govern the transcripts order in the vector, but when, at the next k-mer transcript order is relaxed and positions move, particularly where the significant majority of positions move it is indicative that the intra transcript k-mer condition is relative to other transcript k-mers in the vector. The more and the further transcripts move positions in the vector the more relevant their intra transcript k-mer relationships are likely to be to gene.

This transcript comparative presents a new method for diagnosis and therapy because each new transcript, when compared to the consensus set has the capacity to disrupt order in the vector and yield k-mers that are specifically relevant to the gene. In our assay testing we were able to predict and synthesize ncRNA sequences that significantly reduced proliferation of HeLa cells. In our pre-clinical work, based on comparisons to transcripts of the TP53 consensus we will be predicting the efficacy of cell and tissue selections that educate and activate Natural Killer cells.

Pre-clinical flow chart to educate NK cells with tumor tissue/cell co-cultures and prove prediction

  

A p53 Checkpoint For Cancer Therapy

Enormously complex signaling exists in the communication of antigens, receptors and ligands in DNA pathways between Natural Killer cells (NK) and target cells with which they interact. Based on observations, following NK formation of an immune synapse with its target cell two outcomes occur most often, termination or differentiation. The innate immune system comprises multiple cell types that are present and differentiated in tissues, but the predatory-like activity of NK has led to the general perception of its role in the immune system's front line.

As we have articulated many times on this blog, immunity and reproduction are tied, originally through allorecognition to the conserved p53-mdm2 axis. Further, it has become abundantly clear that auto-regulation of p53 occurs in multiple gene positive and negative feedback loops including mdm2. NK performance in young versus older patients showed a reduced capacity for, synaptic polarization and perforin release into the immune synapse before killing target cell. Further that the reduced release of perforin also reduced the capacity for NK to clear senescent cells associated with aging.

The activation of mitogen‐activated protein kinases (MAPK) is critical for lytic granule (perforin-granzyme) polarization, granule exocytosis and NK Cytotoxicity. It is possible that these proximal signalling events are compromised by aging. In addition, the studied p53 mutants regulated MAP2K3 gene whereas ectopic expression rescued the proliferative defect induced by mutant p53 knockdown.

In one series of experiments it was shown that the mutational status of p53 can facilitate cytotoxicity and different T cell recognition patterns. The p53 protein is presented by MHC molecules and the differential T cell recognition patterns seem confined to p53 as an antigen. The paper suggests p53 may behave differently to other classical tumor antigens, therefore a biomarker for immunotherapy targeting p53 should be the type of mutation expressed rather than protein levels only.

As previously reported, cytoskeleton superfamily member Talin1 has been uniquely tied to two essential NK functions;  activation of LFA1, required for binding ICAM on NK target cell and NK polarization that results. We know overexpression of talin head activates LFA1 and talin1 promotes cell proliferation by affecting the expression of BCL2 family and p53 network. But, mdm2 the conserved nemesis of p53 is neutralized by Merlin, another cytoskeleton superfamily protein also required for polarization. p53 also regulates the highly conserved Cdc42 which effects adhesion, actin cytoskeletal dynamics and cell movement including for angiogenesis in developing tumor microenvironments.

We found that activation of p53 augmented NK cell-mediated cytolysis of tumor cells via induction of ULBP2 expression on tumor cell surface. Further, we identified p53 as a direct transcriptional regulator of ULBP2 via an intron1 binding site, thus revealing previously unknown molecular mechanism controlling NKG2D ligand transcription. In mouse NK cells, talin is required for outside signaling by LFA1, which together with signaling by NKG2D induces granule polarization.

The functions of p53 are inextricably linked to multiple mechanisms in NK and target cells including recognition, antigen-receptor-ligand binding, cytoskeletal rearrangement, immune synapse, granzyme and perforin release. p53's mutation frequency and variances bearing p53 destabilizing mutations are recognized more effectively by p53-specific T cells than stabilized p53 mutants. Therefore, NK could operate its probe as a binding cipher that determines whether its target can be killed. Variable binding, and ectopic expression, resulting from a p53 feedback loop could be dependent on a p53 variable-kill-checkpoint that triggers the cascade of coordinated activities between NK and its target, generally referenced in the preceding paragraphs.

NK's p53 status, a targets MHC molecules presenting p53 antigens, ULBP2-NKG2D binding and relevant pathways confer with observations that the period of NK engagement is sufficient to allow downstream DNA transcription and translation to confirm and enable the kill event. Co-culture methods that could educate NK to better synchronize with targets, based on p53 status may usher in new regimes for organic immunotherapy. The Codondex research teams at Precision Autology are progressing through pre-clinical research using their computed cell selections.

Hope for a p53 Autologous Natural Killer Cell Therapy

Natural Killer Cells (NK) are much more than cell killers! They possess mechanisms and sensitivities that, among many functions, enables them at the front line of reproduction to interact with incoming trophoblasts that invade the uterine wall where NK cells are critical for blastocyst implantation and pregnancy. NK are members of the innate immune system, but they can be licensed to kill and re-purpose cells whereas most innate immune cells directly target invading pathogens.

Maternal decicdual NK may be redirected by PreImplantation Factor (PIF) expressing, anti-apoptopic, extra-villous trophoblasts that invade the endometrium (epithelioid) of the decidua of the uterine wall. This may result from epithelial LIF expression, and LIFR(eceptors) critical for blastocyst implantation. LIF allele's may act as a NK switch, the direct result of a p53 promoter allele that targets specific LIF transcription, that alters NK interactions with trophoblasts, the host endometria and vascular epithelia. If so, redirection of NK is an essential mechanism of conception that underwrites the development of the placenta.

Studies have revealed p53 targets LIF and demonstrated that, as a secreted protein LIF can function through the Stat3/ID1/MDM2 pathway to negatively regulate p53. Selected alleles in SNPs in LIF, Mdm2, Mdm4, and Hausp genes, each of which regulates p53 levels in cells, are also enriched in IVF patients. This association of SNPs in the p53 pathway with human fertility strongly suggests that p53 regulates human reproduction. It is distinctly possible enriched SNP's invoke regulation that negatively affects p53 and may also be the mechanism by which NK switches between modes that kill or transform its cell targets. In implantation, levels of p53  may lead to pre-eclampsia a condition that is the direct result of increased, p53 dependent apoptosis in extra-villous trophoblasts.

Pathogen-associated molecular pattern–mediated metabolic reprogramming can be considered as a manifestation of innate immune signaling, reprogramming a conserved phenomenon, that changes how we think about the biology and function of the innate immune network.

The mode of NK, in response to cancers may determine the fate of its target either by the binding of innate receptor combinations that initiate an immune synapse and perforin-mediated cytolysis or the release cytokines and chemokines that alters the inflammatory response. It was recently demonstrated these combinations are varied by different tissue and disease depending on p53 for example, in lung adenocarcinoma NK limited target killing and reduced inflammatory response allowing the cancer to spread. Further, peptides derived from p53 are presented by class I MHC molecules and may act as tumor-associated epitopes which could also be targeted by p53-specific T cells.  Results show that selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

These complex tissue dependent modes, through p53 pathways that contribute negative or positive feedback loop's, have prevented the most mutated gene in cancer from itself becoming a target of drug or immune therapy. Using a novel approach Precision Autology's Codondex algorithm computed the variable state of p53 isoforms, using a relative vector distance, from the consensus, to select patient cells for co-culture with, at least autologous NK for use in customized therapy. The approach will enable approved labs to identify highly specific cell targets, in part by their p53 state and to educate autologous NK cells based on a single p53 measure so that NK precision can be calibrated via the mismatch of target receptor combinations and p53.