Pathogens And Immunity - Mutual Memories

The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 

Cancer's HLA-G Backdoor

piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.

When Immunity Fails Programmed Cell Death

DNA Damage Response

Telomeric repeat (TR) sequences are responsible for genome integrity, where instability is a primary factor that leads to activation of p53. Introduction of a TR into cells leads to stabilization of p53, specific to TRs and not observed in plasmids containing non-TR sequences. TR-activated p53 exhibited enhanced transcriptional activity and induced p53-dependent growth suppression, measured as a reduction in colony formation. Sub-telomeric p53 binding prevents accumulation of DNA damage at human telomeres.  

Healthy cells experience thousands of DNA lesions per day. Micronuclei, containing broken fragments of DNA or chromosomes, that have become isolated, are recognized as one mediator of DNA damage response (DDR)-associated immune recognition. Like micronuclear DNA, mitochondrial DNA (mtDNA) is recognized by cGAS to drive STING-mediated inflammatory signaling. Mitochondrial damage can intersect DNA repair and inflammatory cascades with programmed cell death, through p53. In human fibroblasts and conditionally immortalized vascular smooth muscle cells p53 mediates CD54 (ICAM-1) overexpression in senescence.

Replicative senescence, an autophagy dependent program and crisis are anti-proliferative barriers that human cells must evade to gain immortality. Telomere-to-mitochondria signaling by ZBP1 mediates replicative crisis. Dysfunctional telomeres activate innate immune responses (IFN) through mitochondrial TR RNA (TERRA)–ZBP1 complexes. Senescence occurs when shortened telomeres elicit a p53 and RB dependent DNA-damage response. A crisis-associated isoform of ZBP1(innate immune sensor) is induced by the cGAS–STING DNA-sensing pathway, but reaches full activation only when associated with TERRA transcripts from dysfunctional telomeres. p53 utilizes the cGAS/STING innate immune system pathway for both cell intrinsic and cell extrinsic tumor suppressor activities. cGAS-STING activation induces the production of IFN-b and increases CD54 expression in  human cerebral microvascular endothelial cells.

In melanoma patients there is a significant correlation between cGAS expression levels and survival and between NK cell receptor expression levels and survival. Loss of cGAS expression by tumor cells could permit the tumor cell to circumvent senescence or prevent immunostimulatory NKG2D ligands expression. Loss of p53 and gain of oncogenic RAS exacerbated pro-malignant paracrine signaling activities of senescence-associated secretory phenotypes. Results imply that heterogeneity in cGAS activity, across tumors, could be an important predictor of cancer prognosis and response to treatment and suggest that NK cells could play an important role in mediating anti-tumor effects. Coculture of wild-type p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. 

When p53 consensus sequences are modified and DNA damage response is compromised, replicative crisis ensues, mitochondrial membranes misfunction, mtDNA expression is downregulated and IFN signaling upregulates. A cell may then express activating immune ligands that bind NK receptors signaling non-self and cytolytic death or inhibitory receptors that signal self and immortality. 

Indispensable Mitochondria - Cancers back door?

Immediately prior to fertilization spermatozoa are devoid of Mitochondrial DNA (mtDNA), potentially explaining an aspect about selection that may serve the legacy for maternal immune tolerance. Post fertilization, on day 11-13, outermost trophoblasts of the blastocyst dock with the decidual lining as it embeds in the uterine wall. Then, maternal vascular remodeling and placental formation begin toward successful implantation. 

Higher quality trophoblasts are associated with lower mtDNA content. Moreover, euploid blastocysts with higher mtDNA content had a lower chance to implant and mtDNA replication is strictly downregulated between fertilization and the implantation. What is it about absent or reduced mtDNA that may also relate to the mechanics of immune tolerance and vascular remodeling, which are also features of solid tumors.

The initial absence or downregulation of MtDNA, may relate an immune tolerance by uterine Natural Killer (NK) cells. As mtDNA upregulates, after day 12, it may initiate NK auto-reactivity required for maternal microvascular remodeling. This auto-immune paradox is a prerequisite for vascular remodeling, which is also seen in localized hypertension, and the likely basis of successful blastocyst implantation. Acutely, micro-hypertension induced mechanical stretch, on endothelial cells, interconnects innate and adaptive immune responses. 

The dominant cell in the decidua is an NK subset (dNK), they express low levels of IFN-γ and express proteins of Renin Angiotensin System (RAS). At day 12 RAS peptide ANP colocalizes to dNK’s suggesting that dNK RAS infers localized responsiveness.  When TFAM, required for transcription of mtDNA, was deleted from cardiomyocytes, after 32 days, animals developed cardiomyopathy and Nppa (gene encoding ANP) and Nppb expression was elevated. 

In monocytes increased endothelial stretch activates STAT3, which is involved in driving almost all pathways that control NK cytolytic activity and reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis. p53, Stat3, and, potentially, the estrogen receptor are thought to act as co-regulators, affecting mitochondrial gene expression through protein-protein interactions. Co-immunoprecipitation of p53 with TFAM suggests it may regulate mitochondrial DNA-damage repair.

Like initial trophoblasts with low level mtDNA, mature cells, like cardiomyocytes that prolong low level mtDNA may also aggravate autoimmune sponsored hypertension that remodels microvascular networks providing nutrients for growth of reduced mtDNA stem cell replicas. Indeed, mitochondrial dysfunction (from depleted mtDNA) does not affect pluripotent gene expression, but results in severe defects in lineage differentiation.

During severe sepsis, intense, on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. This may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. 

Identifying cells that optimally educate cocultured NK cells for precision IFN-γ and cytolytic responsiveness is part of the ongoing work by the Codondex team.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Tolerating Your Non-self!

Immune cells get comfortable with cancer
Courtesy https://deepai.org

A hallmark of cancer, autoimmunity and disease is the aberrant transcription of typically silenced, repetitive genetic elements that mimic Pathogen-Associated Molecular Patterns (PAMP's) that bind Pattern Recognition Receptors (PPR's) triggering the innate immune system and inflammation. Unrestrained, this 'viral mimicry' activates a generally conserved mechanism that, under restraint, supports homeostasis. These repetitive viral DNA sequences normally act as a quality control over genomic dysregulation responding in ways that preferentially promote immune conditions for stability. If aberrantly unrestrained and the 'viral mimicry' is transcribed it may result in undesirable immune reactions that disrupt the homeostasis of cells.

Mitochondrial DNA (mtDNA) are one source of cytosolic double stranded RNA (dsRNA) that is commonly present in cells. Trp53 Mutant Embryonic Fibroblasts (MEF's) contain innate immune stimulating endogenous dsRNA, from mtDNA that mimic PAMP's. The immune response, via RIG-1 like PRR, leads to expression of type 1 interferon (IFN) and proinflammatory cytokine genes. Further, Natural Killer cells also produce a multitude of cytokines that can promote or dampen an immune response. Wild-type p53 suppresses viral repeats and contributes to innate immunity by enhancing IFN-dependent antiviral activity independent of its function as a proapoptotic and tumor suppressor gene. 

Post-translationally modified P53, located in the cytoplasm, enhances the permeability of the mitochondrial outer membrane thus stimulating apoptosis. However, treating Trp53 mutant MEF's with DNA demethylating agent caused a huge increase in the level of transcripts encoding short interspersed nuclear elements and other species of noncoding RNAs that generated a strong type 1 IFN response. This did not occur in p53 wild-type MEF's. Thus it appears that another function of p53 is to silence repeats that can accidentally induce an immune response.

This has several implications for how we understand self versus non-self discrimination. When pathogen-associated features were quantified, specific repeats in the genome not only display PAMP's capable of stimulating PRRs but, in some instances, have seemingly maintained such features under selection. For organisms with a high degree of epigenetic regulation and chromosomal organization immuno-stimulatory repeats release a danger signal, such as repeats released after p53 mutations. Here, immune stimulation may act as back-up for the failure of other p53 functions such as apoptosis or senescence due to mutation. This supports the hypothesis that specific repeats gained favor by maintaining non-self PAMPs to act as sensors for loss of heterochromatin as an epigenetic checkpoint of quality control that avoids genome instability generally. 

When P53 mutates it begins to fail its restraint of viral suppression, this enables a 'viral mimicry' and aberrant immune reactions. These may promote survival of cells that can leverage immunity, promote angiogenesis and heightened proliferation of cancers, or other diseases under modified conditions for non-self tolerance. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Expanding Treatment Horizons

An unrecognized link between p53 function and the immunosurveillance of cancer and infection led to an understanding how p53 influences the expression of MHC molecules at the cell surface via binding interaction with endoplasmic reticulum ERAP1.

Targeted mutations in multiple cancers revealed TP53 gene expression ranged between the 89th and 100th percentile of all expressed transcripts, and raised the possibility that p53 peptides arising from these common mutations might be immunogenic in these patients.

Select KIR-HLA composition favoring antitumor activity could be a promising immunotherapeutic strategy against breast cancer using autologous activated Natural Killer (NK) cell clones. Coexistence of inhibitory and activating killer-cell immunoglobulin-like receptors (KIR) to the same cognate HLA-C2 and HLA-Bw4 ligands conferred breast cancer risk. Inhibitory KIR(iKIR)-HLA pairs without their activating KIR (aKIR)-HLA counterparts were significantly higher in normal controls. Contrarily and adding complexity this suggests NK cells expressing iKIR, to cognate HLA-ligands in the absence of specific aKIR counterparts are instrumental in antitumor response. 

Identification and characterization of the peptides presented by HLA-C, G and E molecules has been lacking behind the more abundant HLA-A and HLA-B gene products. The peptide specificities of these HLA molecules were elucidated using a comprehensive analysis of naturally presented peptides. The 15 most frequently expressed HLA-C alleles as well as HLA-E*01:01 and HLA-G*01:01 were transfected into lymphoblastoid C1R B-cells expressing low endogenous HLA. 

The results (above) include allotype C*02:02 for p53 presentation and indicate the overlap of HLA source protein and top 500 peptides demonstrating the enormous complexity for multivariate analysis of immune response. However,  C*02:02 and C*05:01 have identical contact residues for p8 and p9, the residues of the bound peptide that influences HLA-C interaction with KIR. This suggests peptide effects could contribute to the broader and stronger binding reactions of these two HLA-C allotypes. Interestingly SART3 and MAGEA3 proteins both interact through the p53 pathway and are reported in the peptide study (above) in addition to TP53 to present ligands on C*02:02 and C*05:01. 

Moreover, in vitro  models demonstrated that p53 is required for upregulation of NK ligands. Further, there was a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma (BCC), with a higher likelihood that KIR B carriers harbor abnormal p53 (p<0.004). Together the data suggests functional interactions between KIR and HLA modify risks of BCC and Squamous Cell Carcinoma and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors.

Notwithstanding the enormous complexity between iKIR, aKIR - HLA interactions, immunoterapy must address the highly specific characteristics of autologous precision and discover methods to sensitively educate NK cells so that minimally invasive treatments can be extended to patients who fall outside the patient cohort for strictly regulated treatments. 

Of course, its never that simple...

Evidence of Purposeful Evolution

Darwin's evolution challenged!

A recently published article in Nautre challenged evolution theory suggesting DNA repair was the more likely candidate driving evolutionary development than the environmental conditions thought to be the driver of natural selection. In some sense the two may be linked, but this study showed how epigenome-associated mutation bias reduced the occurrence of deleterious mutations, challenging the prevailing paradigm that mutation is a directionless force in evolution.

Quantitative assessment of DNA gain and loss through DNA double-strand break (DSB) repair processes suggests deletion-biased DSB repair causes ongoing genome shrinking in A. thaliana, whereas genome size in barley remained nearly constant.

Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DSB repair. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome.

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate Natural Killer (NK) cells are unable to express RAGs or RAG endonuclease activity during ontogeny. They exhibit a cell-intrinsic hyperresponsiveness, but a diminished capacity to survive following virus-driven proliferation, a reduced expression of DNA damage response mediators, and defects in the repair of DNA breaks. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors marks functionally distinct subsets of NK cells in the periphery, demonstrating a novel role for RAG in the functional specialization of the NK cell lineage. 

The most active region of Human Chromosome 19 has a long history of recombinations that define the expression patterns of telomeric and centromeric proportions of Killer-cell immunoglobulin-like receptor (KIR) gene's encoding receptors. KIR's bind cells presenting MHC class 1 HLA haplotype combinations, that vary significantly across tissues in different population groups. Further, the deletion rate in Zinc Finger clusters (ZNF) located around 19q13.42, near KIR and C19MC between 51,012,739 and 55,620,741 are about twofold higher than the background deletion rate. 

The relationship between deletions and mutation may indeed play a direct role in rapidly evolving, innate immunity. This may just begin to explain the speed at which global populations can respond and survive pandemics caused by the likes of COVID-19. And, the '19' in its nomenclature may go beyond time to the very chromosome responsible for innate immune diversity.

Retroviral Defense And Mitochondrial Offense

Chromosomal DNA has played host to the long game of viral insertions that repeat and continue as a genetic and epigenetic symbiosis along its phosphate and pentose sugar backbone. But, the bacterial origin of mitochondria and its hosted DNA also promotes its offense. 

Research suggests that retrovirus insertions evolved from a type of transposon called a retrotransposon. The evolutionary time scales of inherited, endogenous retroviruses (ERV) and the appearance of the zinc finger gene that binds its unique sequences occur over same time scales of primate evolution. Additionaly the zinc-finger genes that inactivate transposable elements are commonly located on chromosome 19. The recurrence of independent ERV invasions can be countered by a reservoir of zinc-finger repressors that are continuously generated on copy number variant (CNV) formation hotspots.

One of the more intiguing aspects of prevalent CNV hotspots on chromosome 19 are their proximity to killer immunoglobulin receptor gene's (KIR's) and other critical gene's of the innate immune system.

Frequently occuring DNA breaks can cause genomic instability, which is a hallmark of cancer. These breaks are over represented at G4 DNA quadruplexes within, hominid-specific, SVA retrotransposons and generally occur in tumors with mutations in tumor suppressor genes, such as TP53. Cancer mutational burden is shaped by G4 DNA, replication stress and mitochondrial dysfunction, that in lung adenocarcinoma downlregulates SPATA18, a mitochondrial eating protein (MIEAP) that contributes to mitophagy. 

Genetic variations, in non-coding regions can control the activity of conserved protein-coding genes resulting in the establishment of species-specific transcriptional networks. A chromosome 19 zinc finger, ZNF558 evolved as a suppressor of LINE-1 transposons, but has since been co-opted to singly regulate SPATA18. These variations are evident from a panel of 409 human lymphoblastoid cell lines where the lengths of the ZNF558 variable number tandem repeats (VNTR) negatively correlated with its expression. 

Colon cancer cells with p53 deletion were used to analyze deregulated p53 target genes in HCT116 p53 null cells compared to HCT116-p53 +/+ cells. SPATA18 was the most upregulted gene in the differential expression providing further insight to p53 and mitophagy via SPATA18-MIEAP.

p53 response elements (p53RE) can be shaped by long terminal repeats from endogenous retroviruses, long interspersed nuclear repeats, and ALU repeats in humans and fuzzy tandem repeats in mice. Further, p53 pervasively binds to p53REs derived from retrotransposons or other mobile genetic elements and can suppress transcription of retroelements. The p53- mediated mechanisms conferring protection from retroelements is also conserved through evolution. Certainly, p53 has been shown to have other roles in DNA  context, such as playing an important role in replication restart and replication fork progression. The absence of these p53-dependent processes can lead to further genomic instability. 

The frequency of variable length, long or short nucleotide repeats and their locations within a gene may be key to the repression of DNA sequences that would otherwise cause genomic instability or protein expressions that would eat bacterial mitochondria or destroy its cell host. 

The complexity of variable length insertions is made evident when exhaustively analyzing a simple length 12 sequence for the potential frequency of each of its variable length repeats starting from a minumum variable length of 8.

Then, for TGTGGGCCCACA(12)

All possible internal variable length combinations from and including length 8:

TGTGGGCC(8)|GTGGGCCC(8)|TGTGGGCCC(9)|TGGGCCCA(8)|GTGGGCCCA(9)|TGTGGGCCCA(10|GGGCCCAC(8)|TGGGCCCAC(9)|GTGGGCCCAC(10)|TGTGGGCCCAC(11)|GGCCCACA(8)|GGGCCCACA(9)|TGGGCCCACA(10)|GTGGGCCCACA(11)|TGTGGGCCCACA(12)

For example, reviewing length (8) only:

TGTGGGCC (8) occurs 5 times

GTGGGCCC (8) occurs 8 times

TGGGCCCA (8) occurs 9 times

GGGCCCAC (8) occurs 8 times

GGCCCACA (8) occurs 5 times

Any repeat can be ranked based on its ocurrence within all possible combinations of a given sequence, known as the repeats' iScore rank. This illustrates a potential useful statistical ranking that, subject to biology may describe a repeats inherency to be more or less effective, in increments of the gene sequence. 

Repression of the most active sequences, especially in context of repeats may result in genetic variation. 

Chemo vs. Mecho

Data strongly suggests interaction between plasma membrane and submembrane at the endothelial surface controls the inflammatory response. 

A meta-analysis from six studies of global gene expression profiles of Blood Pressure (BP) and hypertension was performed in 7017 individuals. 34 genes were differentially expressed. Of these, 6 genes were linked including MYADM, which was the only gene, of 34 discovered across diastolic, systolic BP and hypertension. Knockdown of MYADM (19q13), a component of endothelial surface rafts induced an inflammatory phenotype altering barrier function through the increase of the adhesion receptor ICAM-1 (19p13). This is mediated by MYADM activation of ERM actin cytoskeleton proteins. 

Mechanical forces, without a definitive direction e.g., disturbed flow and relatively undirected stretch at branch points and other complex regions cause sustained molecular signaling of pro-inflammatory and proliferative pathways that include mechanical stretch tied to p53. 

ERM proteins also facilitate Sphingosine-1-phosphate (S1P) dependent egress for T-cells to migrate from lymphoid organs. Their directional migration, by blebbing is contained at the T-cell’s leading edge. This fundamentally different mode of migration is characterized by intracellular pressurization. Of the five S1P receptors S1P2 (19p13) is critical in the immune, nervous, metabolic, cardiovascular, musculoskeletal, and renal systems. Results suggest that the ratio between S1P1 and S1P2 (19p13) governs the migratory behavior of different T cell subsets. 

Human NK cells express S1P1 mRNA. Activation with IL-2 increases S1P1, promotes S1P4 (19p13) and S1P5 (19p13) but not S1P2 (19p13) expression. Unlike S1P1, S1P2 (19p13) signals through several different G-alpha subunits, Gi, G12/13, and Gq. S1P5 (19p13) is also expressed in human and mouse NK cells and was required for mobilization to inflamed organs. S1P5-deficient mice had aberrant NK cell homing during steady-state conditions. NK cell trafficking in vivo requires a dedicated sphingosine 1-phosphate receptor. 

Virus-infected mast cells selectively recruit NK cells and positively modulate their functions through mechanisms dependent on soluble mediators, such as interferons. Skin mast cells protect mice against vaccinia virus by triggering mast cell receptor S1P2 (19p13) and releasing antimicrobial peptides. S1P2 (19p13),  a negative regulator of platelet derived growth factor (PDGF) induced migration and proliferation as well as SphK1 expression. 

S1P inhibits macropinocytosis (internalizing extracellular materials) and phosphorylation of Akt via S1P2 (19p13) stimulation resulting in diminished antigen capture.

S1P1, S1P2 (19p13) and S1P3 receptors have redundant or cooperative functions for the development of a stable and mature vascular system during embryonic development. S1P2 (19p13)  and S1P3 are involved in regulation of endothelial barrier function, fibrosis, and vasoconstriction. 

Adipogenic differentiation is inhibited by S1P2 (19p13) as mediated by C/EBPα and PPARγ, which induces PEPCK, a more recent gene of interest in cancer that acts at the junction between glycolysis and the Krebs cycle.

Mecho or chemo, chicken or egg, what first?

Life, Dormancy or Death?

Cellular biology is viewed through different lenses, but pregnancy offers a perspective on the invasive origin of cell division, the senescent state and cancer. Pregnancy causes Natural Killer cells of the decidua (dNK) to expand abundantly until they represent as much as 30% of the mucous membranes' cells. NK cells may be induced to expand by invading trophoblasts to realize the dNK trifecta - robust innate immunity that protects the embryo from maternal infection, modulation of trophoblast invasion and driver of vascular remodeling. However, in many cancers expansion of diverse NK populations fails to materialize and missing sub-sets of NK cell diversity provides a path for cancers unchecked growth. 

In decidual cells at the human maternal-fetal interface, CD82 - the metastasis suppressor may participate in intercellular communication with trophoblasts and limit their invasiveness. Trophoblasts enhance adhesiveness of dNK to the decidua's stromal cells, via the CXCL12/CD82/CD29 signaling pathway which contributes to CD56bright NK cell enrichment a necessary element for heathy pregnancy.

CD82 expression is downregulated in tumor progression of many human cancers and strongly correlated with tumor suppressor p53. It can be activated by p53 through a consensus binding sequence in the promoter. In human ovarian cancer a sequential genetic change at the TP53 and the CXCL12 receptors CXCR4  locus occurs during transformation of surface epithelium. Basal CXCR4 promoter activity in HCT116 colon carcinoma cells deleted of p53 was10-fold higher compared to that in parental HCT116 cells with functional wild-type p53.

The CXCL12 ligand is unique for its CXCR4 receptor and both are expressed in human first-trimester endometrial epithelial cells (EECs) at the mRNA and protein level. EEC-conditioned medium and recombinant human CXCL12 significantly increased the migration and invasion of EECs. CXCL12 has also been associated with the recruitment of CD56bright CD25+ dNK subsets in early pregnancy's.

CXCR4 is specifically upregulated in the human endometrium during the implantation window and increased immunostaining observed only when a blastocyst is present. CXCR4/CXCL12 not only enhances trophoblast invasiveness, but also limits over-invasiveness by upregulating CD82. CXCR4 activation increases the CXCL12-CXCR4 signaling axis stimulates vascular endothelial growth factor (VEGF) synthesis which induces CXCR4 and CXCL12 production. This synergistic regulation influences placental vascularization. CXCR4 suppresses apoptosis and increases the viability of trophoblasts. 

Undetectable disseminated tumor cells, in different tissue microenvironments restrain or allow the progression of breast cancer in the liver where in dormant milieu's there are selective increases in NK cells. Stroma crosstalk and exit from dormancy follows a marked contraction of the NK cell compartment and concurrent accumulation of activated hepatic stellate cells (aHSCs). Proteomics on liver co-cultures implicate aHSC-secreted CXCL12 in the induction of NK cell quiescence through CXCR4. CXCL12 expression and aHSC abundance are closely correlated in patients with liver metastases and were inversely correlated with NK cell abundance.

The dNK behavior that checks trophoblast invasion and promotes vascularization resembles immediate and invasive new cancers that may occur in cells of any tissue environment. Similarly expansion of resident tissue NK sub-sets in response may be the determiner of life, the shape of next generation cells, dormancy or death.  

Immunity keeping p53 in check!

In a 2012 study on the topology of the human and mouse m6A RNA methylomes, Gene Ontology (GO) analysis of differentially expressed genes (DEG's) indicated a noteworthy enrichment of the p53 signaling pathway: 22/23 genes had differentially expressed splice variants, of which 18 were methylated. Moreover, 15 other members of the signaling pathway, which were not significant DEG's, exhibited significant differential isoform expressions. For example, isoforms of MDM4, needed for p53 inactivation were downregulated. Similar pro-apoptotic effects were observed in other pathway genes including MDM2, FAS and BAX. Higher apoptosis rate in HaCaT-T cells resulted with knockdown of m6A subunit METTL3, which also reversed a significant decrease in p53 activity. Modulation of p53 signaling through splicing may be relevant to induction of apoptosis by silencing of METTL3. 

Then, in 2019 a study of arsenite-induced human keratinocyte transformation demonstrated that knockdown of METTL3 significantly decreased m6A level, restored p53 activation and inhibited cellular transformation phenotypes in the-transformed cells. Further, m6A downregulated the expression of the positive p53 regulator, PRDM2, through the YTHDF2-promoted decay of PRDM2 mRNAs. m6A also upregulated expression of negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. Taken together, the study revealed the novel role of m6A in mediating human keratinocyte transformation by suppressing p53 activation and sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.

Finally in 2021 a discovery that YTHDF2 is upregulated in NK cells upon activation by cytokines, tumors, and cytomegalovirus infection. Ythdf2 deficiency in NK cells impaired its anti-tumor and anti-viral activity in vivo. YTHDF2 maintains NK cell homeostasis and terminal maturation, correlating with modulating NK cell trafficking and regulating Eomes, respectively. It promotes NK cell effector function and is required for IL-15-mediated NK cell survival and proliferation by forming a STAT5-YTHDF2 positive feedback loop. Analysis showed significant enrichment in cell cycle, division, and division-related processes, including mitotic cytokinesis, chromosome segregation, spindle, nucleosome, midbody, and chromosome. This data supports roles of YTHDF2 in regulating NK proliferation, survival, and effector functions. Transcriptome-wide screening identified Tardbp (TDP-43) to be involved in cell proliferation or survival as a YTHDF2-binding target in NK cells.

Downregulation of METTL3, which in spinal cord contributes with YTHDF2 to modulate inflammatory pain may upregulate differentially expressed p53 network splice variants that oppose YTHDF2 induced downregulation of p53, via PRDM2 leading to apoptotic or diseased cells. In diseased environments cytokines may upregulate YTHDF2 in NK cells leading to downregulation of p53 and cytoskeletal transformation that may be sufficient, at an immune synapse to advance cytolysis.

p53 signals may inform selections of cells and tissue that prime NK cells for advanced, personalized immune therapy. 

First Intron DNA - Site for a Genetic Brain?

DNA Methylation

The first intron of a gene, regardless of tissue or species is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Therefore, it is an informative gene feature regarding the relationship between DNA methylation and gene expression. But, expression in induced pluripotent stem cells (iPSC's) has been a major challenge to the stem cell industry, because by comparison these cells have not yet reached the state of natural pluripotent or embryonic stem cells (ESC's).

In mice two X chromosomes (XC) are active in the epiblasts of blastocysts as well as in pluripotent stem cells. One XC is inactivated triggered by Xist (non coding) RNA transcripts coating it to become silent. Designer transcription factor (dTF) repressors, binding the Xist intron 1 enhancer region caused higher H3K9me3 methylation and led to XC's opening and X-linked gene repression in MEFs. This substantially improved iPSC production and somatic cell nuclear transfer (SCNT) preimplantation embryonic development. This also correlated with much fewer abnormally expressed genes frequently associated with SCNT, even though it did not affect Xist expression. In stark contrast, the dTF activator targeting the same enhancer region drastically decreased both iPSC generation and SCNT efficiencies and induced ESC differentiation. 

A genome-wide, tissue-independent quasi-linear, inverse relationship exists between DNA methylation of the first intron and gene expression. More tissue-specific, differentially methylated regions exist in the first intron than in any other gene feature. These have positive or negative correlation with gene expression, indicative of distinct mechanisms of tissue-specific regulation. CpGs in transcription factor binding motifs are enriched in the first intron and methylation tends to increase with distance from the first exon–first intron boundary, with a concomitant decrease in gene expression.

Since the relationship between sequence, methylation, repression and transcription is determinative in ESC differentiation it may also suggest a broader link to differential translation. Translation is required for miRNA-dependent transcript destabilization that alters levels of coding and noncoding transcripts. But, steady-state abundance and decay rates of cytosolic long non-coding RNA's (lncRNAs) are insensitive to miRNA loss. Instead lncRNAs fused to protein-coding reporter sequences become susceptible to miRNA-mediated decay. 

In this model, first intron DNA sequences that are differentially methylated, bind transcription factors that effect transcription, impact splicing, expressions of coding or non-coding transcripts and transcript destabilizations resulting in differential rates and possible variations in translation. This bottom-up, dynamic view of the classical process may elevate the first intron from 'junk' to a DNA 'brain' because it plays a more extensive role, heading the process toward translation of any gene or switching it off entirely.  

For this reason, among others Codondex uses first intron k-mers relative to the transcripts mRNA as the basis for comparing same gene transcripts in diseased cells or tissue samples. Further, p53 and BRCA1 miRNA key sequences, discovered using Codondex iScore algorithm, when transfected into HeLa cells resulted in significantly reduced proliferation that may result from this accelerated, transfected miRNA dependent decay.

 

Short Sequences of Proximally Disordered DNA

Oxford Nanopore Device Reducing Sequencing Cost

Relationships exist between short sequences of proximal DNA (SSPD) of a gene that when transcribed into RNA present stronger or weaker binding attractions to RNA binding proteins (RBP'S) that settle, edit, splice and resolve messenger RNA (mRNA). Responsive to epigenetic stimuli on Histones and DNA, mRNA are constantly transcribed in different quantity, at different times such that different mRNA strands are transported from the nucleus to cytoplasm where they are translated into and produce any of more than 30,000 different proteins.

Single nucleotide polymorphisms and DNA mutations can alter SSPD combinations in different diseased cells thus altering sequence proximity, ordering that affects transcribed RNA's attraction and optimal binding of RBP's. This may result in modified splicing of RNA, assembly of mRNA and slight or major variations in some or all translated protein derived from that gene. 

The specific effects of these DNA variations, on the multitude of proteins produced are generally unknown. However, it remains important to understand their effects in disease, diagnosis and therapy. Typically these have historically been researched by large scale analysis of RBP on RNA as opposed to the more fundamental, yet underrepresented massive array of diseased variant DNA to mRNA transitions.

Most pharmaceutical research is directed to a molecular interference targeting an aberrant protein to cure widely represented or highly impactful disease conditions of society. Economic assessments generally influence government decisions to support research based on loss of GDP contribution by a specific disease in a  patient cohort. However, in the modern multi-omics era top down research into protein-RNA activity is descending deeper into the cell to include RNA-mRNA and mRNA-DNA customizable therapies that will eventually resolve individually assessed diseases at a price that addresses much larger array of patient needs.  

SNP's and other mutations can vary considerably in cells. These variations can cause instability during division and lead to translated differences that can ultimately drive cancerous cell growth to escape patient immunity. Like a 'whack-a-mole' game, pattern variation and mechanistic persistence eventually beat the player. Without effective immune clearance these cells can replicate into tumors and contribute to microenvironments that support their existence.

Link to video on tumor microenvironment https://youtu.be/Z9H2utcnBic

We thought to analyze DNA and mRNA transcripts from cells in tumors and their microenvironments to see if we could expose the SSPD disordered combinations that may have promoted sub-optimal RBP attractions and led to sustained immune escape. Given the complexity of DNA to mRNA transcription, for any given gene many distortions in gene data sets have to be filtered. To do that we focused on p53, the most mutated gene in cancer. We designed a method to compare sequences arrays of DNA and mRNA Ensembl transcripts, from the consensus of healthy patients to multiple cell samples extracted from different sections of a patients tumor and tumor microenvironment.     

We previously identified and measured different levels of Natural Killer (NK) cell cytotoxicity, produced from cocultures with the extracted samples of each of the multiple sites of a biopsy. We will measure the different p53 transcript SSPD combinations associated with each sample and determine whether disordered SSPD's corelate with NK cytotoxicity from each coculture. We expect to identify whether biopsied tumor cells, ranked by SSPD's predict the cytotoxicity resulting from NK cell cocultures. We will narrow our research to identify the varied expressions of receptor combinations associated with degrees of cytotoxicity. We will test immune efficacy to lyse and destroy tumor cells. Finally we will test for adaptive immune response. 

Our vision is for per-patient, predictable cell co-culture pairings, for innate immune cell education based on ranking DNA-mRNA combinations to lead to multiple effective therapies. The falling cost of sequencing and sophistication of GMP laboratories presently servicing oncologists may support a successful use of this analytical approach to laboratory assisted disease management.

   

 

Non-Coding DNA Key Sequences

DNA Structural Inherency

Wind two strands of elastic, eventually it will knot, ultimately it will double up on itself. Separate the strands. From the point of unwinding, forces will be directed to different regions and the separation will approximately return to the wound state of the band. Do the same with each of 10 different bands or strings of any type, they will all behave in much the same way. For a given section of DNA being transcribed, the effect of separation will be much the same. For a given gene, there will be sequences that can tolerate force to greater or lesser degrees. For different transcripts, of a gene variation at those sequences may be crucial to the integrity of transcription machinery that separates DNA strands to initiate replication to RNA and for the outcome.

Cellular biology is enormously complex in all regards. The physics of molecular interaction, fluid dynamics, and chemistry combine in a system where cause and effect is near impossible to predict. At the most elementary level we hypothesize some non-coding DNA (ncDNA) possess structural inherencies that can be deployed to direct gene proteins and cell function for diagnosis or therapy.

Coding DNA and its regulatory, non-coding gene compliment is transcribed and spliced from a transcribed gene. Transcription to RNA, edited mRNA, spliced non-coding RNA and ultimately mRNA translation to protein can produce wide ranging, variable outcomes that may not be re-captured experimentally. 

A single nucleotide polymorphism (SNP) or SNP combinations within a gene may affect the finely tuned balance that results. Under different environmental conditions this could be material to the protein produced. Additionally other mutations of the gene could add complexity to the environment and/or the  resulting protein translation. 

At this level of cellular biology, genetic DNA stores instruction for protein assemblies to produce new protein required for the fully functional cell. However, DNA's stored mutations can lead to different functional or non-functional versions of protein depending on many different factors. Relationships between ncDNA, including mutations and the transcripts' edited, protein coding mRNA may represent unexplored inherencies that can regulate the gene's mRNA or translated protein.

We built an algorithm to elaborately compare ncDNA sequences of multiple protein coding transcripts of the same gene. For each transcript it steps through every variable length ncDNA sequence (kmer) (specifically intron1), computes a signature for each and indexes it to the constant of the transcripts' mRNA signature. For each step these signatures order the kmers for each of the transcript's. The order is represented in a vector of all the transcripts being compared.  

At millions of successive steps (depending on total intron 1 length's) transcripts mostly retain their vector ordering except, as expected at a kmer length change. Mostly transcript order in the vector does not change, occasionally a few positions change, vary rarely do all positions change. Position changes that cause another, like a domino effect are filtered out. For the rarest positions changes at a step, we look to the root causes in the kmer (sequence). We call this a Key Sequence because it is identified by the significance of changes to transcript positions in the vector compared to the vector at the next step. 

Therefore, Key Sequences cause the most position changes between transcripts being compared by the algorithm. This relative measure is step dependent and Key Sequences are discovered by comparing transcript positions in the vector at the next step location. Logically, this infers a genes structural inherency discovered through ncDNA Key Sequence relationships to mRNA, to other transcripts, error in gene alignments, sequenced reads or the algorithm. 

In assay testing we were able to predict and synthesize non-coding RNA Key Sequences that significantly reduced proliferation of HeLa cells. In our pre-clinical work, based on comparisons to transcripts of the TP53 we will be predicting the efficacy of cell and tissue selections that educate and activate Natural Killer cells.

If Key Sequences are inherent they could open a new frontier for diagnosis and therapy.