Wednesday, May 17, 2023

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 


Tuesday, March 21, 2023

Tolerating Your Non-self!

Immune cells get comfortable with cancer
Courtesy https://deepai.org

A hallmark of cancer, autoimmunity and disease is the aberrant transcription of typically silenced, repetitive genetic elements that mimic Pathogen-Associated Molecular Patterns (PAMP's) that bind Pattern Recognition Receptors (PPR's) triggering the innate immune system and inflammation. Unrestrained, this 'viral mimicry' activates a generally conserved mechanism that, under restraint, supports homeostasis. These repetitive viral DNA sequences normally act as a quality control over genomic dysregulation responding in ways that preferentially promote immune conditions for stability. If aberrantly unrestrained and the 'viral mimicry' is transcribed it may result in undesirable immune reactions that disrupt the homeostasis of cells.

Mitochondrial DNA (mtDNA) are one source of cytosolic double stranded RNA (dsRNA) that is commonly present in cells. Trp53 Mutant Embryonic Fibroblasts (MEF's) contain innate immune stimulating endogenous dsRNA, from mtDNA that mimic PAMP's. The immune response, via RIG-1 like PRR, leads to expression of type 1 interferon (IFN) and proinflammatory cytokine genes. Further, Natural Killer cells also produce a multitude of cytokines that can promote or dampen an immune response. Wild-type p53 suppresses viral repeats and contributes to innate immunity by enhancing IFN-dependent antiviral activity independent of its function as a proapoptotic and tumor suppressor gene. 

Post-translationally modified P53, located in the cytoplasm, enhances the permeability of the mitochondrial outer membrane thus stimulating apoptosis. However, treating Trp53 mutant MEF's with DNA demethylating agent caused a huge increase in the level of transcripts encoding short interspersed nuclear elements and other species of noncoding RNAs that generated a strong type 1 IFN response. This did not occur in p53 wild-type MEF's. Thus it appears that another function of p53 is to silence repeats that can accidentally induce an immune response.

This has several implications for how we understand self versus non-self discrimination. When pathogen-associated features were quantified, specific repeats in the genome not only display PAMP's capable of stimulating PRRs but, in some instances, have seemingly maintained such features under selection. For organisms with a high degree of epigenetic regulation and chromosomal organization immuno-stimulatory repeats release a danger signal, such as repeats released after p53 mutations. Here, immune stimulation may act as back-up for the failure of other p53 functions such as apoptosis or senescence due to mutation. This supports the hypothesis that specific repeats gained favor by maintaining non-self PAMPs to act as sensors for loss of heterochromatin as an epigenetic checkpoint of quality control that avoids genome instability generally. 

When P53 mutates it begins to fail its restraint of viral suppression, this enables a 'viral mimicry' and aberrant immune reactions. These may promote survival of cells that can leverage immunity, promote angiogenesis and heightened proliferation of cancers, or other diseases under modified conditions for non-self tolerance.