Showing posts with label hla. Show all posts
Showing posts with label hla. Show all posts

Monday, March 10, 2025

p53 Mitochondrial Relocation Starts The Balls Rolling

 


Key Points

  • Research suggests p53 can relocate to mitochondria under stress, like increased ROS from mitochondrial dysfunction, potentially reducing nuclear p53 levels.

  • It seems likely that this relocation could impair p53’s nuclear functions, including regulating LINE1 transposons and histone marking, leading to genomic instability.

  • The evidence leans toward this process contributing to chromosomal rearrangements and immune responses if unchecked, but the exact mechanisms are still debated.


Direct Answer

Understanding the Process

When mitochondria don’t work properly, like when their membrane potential is altered due to damage or inefficient energy production, it can lead to more reactive oxygen species (ROS), which are harmful molecules. This stress can cause the p53 protein, known as the "guardian of the genome," to move from the nucleus and cytoplasm to the mitochondria. This movement might lower the amount of p53 available in the nucleus, where it normally helps control genes, including those that keep LINE1 transposons in check. LINE1 transposons are mobile DNA pieces that can cause problems if they move around too much.

Impact on p53 Functions

With less p53 in the nucleus, its ability to bind to DNA and mark histones—chemical tags on DNA that control gene activity—could be reduced. This might mean it can’t properly restrain LINE1 transposons, leading to increased activity. If this balance is disrupted, it could cause chromosomal rearrangements, where DNA breaks and reforms incorrectly, and trigger immune responses as the body tries to fix the damage.

Evidence and Uncertainty

Studies show p53 does move to mitochondria under oxidative stress, and it’s involved in regulating transposons (P53 and the defenses against genome instability caused by transposons and repetitive elements). There’s also evidence that transposons can activate immune responses (Sensing of transposable elements by the antiviral innate immune system). However, it’s not fully clear how much this specific pathway contributes, and researchers are still exploring the details. An unexpected detail is that p53’s mitochondrial role might also protect against some forms of cell death, adding complexity to its effects.


Survey Note: Detailed Analysis of p53 Mitochondrial Relocation and Its Implications

p53, often referred to as the "guardian of the genome," is a critical tumor suppressor protein that responds to cellular stress, including DNA damage, oxidative stress, and mitochondrial dysfunction. The query explores whether altered mitochondrial membrane potential, due to membrane damage or electron transport chain inefficiency leading to increased reactive oxygen species (ROS), can trigger p53’s mitochondrial relocation, affecting its nuclear and cytoplasmic pools, and subsequently impacting its roles in LINE1 (L1) transposon restraint, DNA binding, and histone marking. This could potentially lead to chromosomal rearrangements and immune responses if the finely tuned balance is disrupted. This section provides a comprehensive analysis, drawing on recent literature to address each component of the query.

Mitochondrial Dysfunction and ROS Generation

Mitochondrial membrane potential (Δψm) is essential for the electron transport chain’s function, facilitating ATP production. Alterations, such as those caused by membrane damage or electron transport chain inefficiency, can disrupt this potential, leading to electron leakage and increased ROS production. Studies, such as Mitochondrial Translocation of p53 Modulates Neuronal Fate by Preventing Differentiation-Induced Mitochondrial Stress, highlight that mitochondrial membrane depolarization and transient ROS production occur under stress, such as during neural differentiation, aligning with the query’s premise.

ROS, including superoxide and hydrogen peroxide, are byproducts of mitochondrial respiration, and their overproduction under dysfunctional conditions is well-documented. A ROS rheostat for cell fate regulation notes that mitochondria are the dominant source of ROS under physiological conditions, and their dysregulation can provoke oxidative stress, a known activator of p53.


p53 Mitochondrial Relocation in Response to ROS

p53’s relocation to the mitochondria under stress is a transcription-independent mechanism, often triggered by oxidative stress and ROS. ROS and p53: versatile partnership discusses p53 as a redox-active transcription factor, with mitochondrial translocation being a response to oxidative stress. Translocation of p53 to Mitochondria Is Regulated by Its Lipid Binding Property to Anionic Phospholipids and It Participates in Cell Death Control ... further supports that p53’s mitochondrial translocation is regulated by its interaction with mitochondrial components, particularly under stress conditions like ROS exposure.

Mitochondrial Uncoupling Inhibits p53 Mitochondrial Translocation in TPA-Challenged Skin Epidermal JB6 Cells suggests that mitochondrial uncoupling, which can result from membrane potential changes, affects p53’s translocation, implying a direct link between mitochondrial dysfunction and p53 localization. This aligns with the query’s suggestion that altered mitochondrial membrane potential and increased ROS can drive p53 to the mitochondria.

Impact on p53 Nuclear and Cytoplasmic Pools

When p53 relocates to the mitochondria, it must exit the nucleus, reducing its nuclear concentration. This is facilitated by nuclear export signals (NES) and post-translational modifications, such as monoubiquitination, as noted in Regulation of p53 localization. The reduction in nuclear p53 affects its availability for transcriptional activities, including DNA binding and histone marking, which are nuclear functions.

The cytoplasmic pool may also be affected, as p53 transits through the cytoplasm en route to the mitochondria. The importance of p53 location: nuclear or cytoplasmic zip code? reviews how p53’s subcellular localization is tightly regulated, and its movement to mitochondria can alter the balance between nuclear, cytoplasmic, and mitochondrial pools, supporting the query’s claim.

Replenishment and Reduction of Nuclear p53 for L1 Restraint

The query for this research specifically mentions “replenishment reduces nuclear p53 for L1 restraint,” suggesting that the reduced nuclear p53 impacts its role in restraining LINE1 (L1) transposons. p53’s role in transposon regulation is less canonical than its DNA damage response, but recent studies, such as P53 and the defenses against genome instability caused by transposons and repetitive elements, demonstrate that p53 regulates transposon movement, particularly through piRNA-mediated interactions in model organisms like Drosophila and zebrafish.

p53 in the Game of Transposons further shows that p53 loss leads to derepression of retrotransposons, including LINE1, with epigenetic changes like loss of H3K9me3 marks at regulatory sequences. Given that p53’s transposon regulation is a nuclear function, requiring DNA binding and transcriptional control, a reduction in nuclear p53 due to mitochondrial relocation would logically impair this restraint, as suggested by the query.

Altered Contribution to p53 Binding DNA and Histone Marking

p53’s nuclear functions include binding to DNA at response elements to activate or repress genes, and it indirectly influences histone marking by recruiting histone-modifying enzymes like p300/CBP for acetylation (e.g., H3K27ac) or HDACs for deacetylation. DNA Damage Promotes Histone Deacetylase 4 Nuclear Localization and Repression of G2/M Promoters, via p53 C-terminal Lysines shows p53’s role in histone modification post-DNA damage, requiring nuclear localization.

If nuclear p53 is reduced, its ability to bind DNA and participate in histone marking diminishes. p53 nuclear localization: Topics by Science.gov emphasizes that abnormal p53 localization can inactivate its function, supporting the query’s claim that reduced nuclear p53 alters these contributions. p53 secures the normal behavior of H3.1 histone in the nucleus by regulating nuclear phosphatidic acid and EZH2 during the G1/S phase further illustrates p53’s role in histone modification, which would be compromised if it’s not in the nucleus.

Consequences: Chromosomal Rearrangements and Immune Response

If p53’s restraint on L1 transposons is reduced, increased transposon activity can lead to insertional mutagenesis, causing chromosomal rearrangements, deletions, or duplications. Transposons, p53 and Genome Security notes that unrestrained transposons can contribute to malignancies through such genomic instability.

Additionally, transposons can trigger immune responses. Sensing of transposable elements by the antiviral innate immune system discusses how TE-derived nucleic acids can activate the type I interferon (IFN) response, mistaking them for viral invaders. Transposon-triggered innate immune response confers cancer resistance to the blind mole rat shows RTEs activating cGAS-STING pathways, inducing cell death and immune responses, supporting the query’s link to immune activation.

Finely Tuned Balance and Unchecked Consequences

The query’s mention of a “finely tuned balance” refers to the delicate regulation of p53’s subcellular localization and functions. If unchecked, the reduced nuclear p53 and increased transposon activity could lead to genomic instability, as seen in cancer cells with p53 mutations, and immune activation, potentially contributing to inflammation or autoimmune responses, as suggested by Transposable element expression in tumors is associated with immune infiltration and increased antigenicity.

Table: Summary of Key Mechanisms and Evidence

Mechanism

Description

Evidence Source

Mitochondrial Dysfunction → Increased ROS

Altered Δψm leads to electron leakage and ROS production.

Mitochondrial Translocation of p53 Modulates Neuronal Fate

ROS → p53 Mitochondrial Relocation

p53 translocates to mitochondria under oxidative stress.

ROS and p53: versatile partnership

Reduced Nuclear p53

Mitochondrial relocation decreases nuclear p53 availability.

The importance of p53 location: nuclear or cytoplasmic zip code?

Impaired L1 Restraint

Reduced nuclear p53 impairs transposon repression, increasing L1 activity.

p53 in the Game of Transposons

Altered DNA Binding and Histone Marking

Less nuclear p53 reduces DNA binding and histone modification capabilities.

DNA Damage Promotes Histone Deacetylase 4 Nuclear Localization

Chromosomal Rearrangements

Increased L1 activity causes insertional mutagenesis and genomic instability.

Transposons, p53 and Genome Security

Immune Response Activation

Transposon activity triggers innate immune responses, like type I IFN.

Sensing of transposable elements by the antiviral innate immune system

Conclusion

In conclusion, it is conceivable and supported by evidence that altered mitochondrial membrane potential, leading to increased ROS from mitochondrial dysfunction, can trigger p53’s mitochondrial relocation, reducing nuclear p53 levels. This reduction likely impairs p53’s roles in restraining LINE1 transposons, binding DNA, and participating in histone marking, potentially leading to chromosomal rearrangements and immune responses if the balance is disrupted. While each step is backed by research, the exact contributions and interactions remain areas of active study, reflecting the complexity of p53’s multifaceted roles.

Key Citations

Wednesday, February 19, 2025

P53 - Stability and Life Or Disorder and Death!

Chromosomal stability is central to good health, but the push and shove war of genesis, division, transcription, replication and restraint can promote disorder. Disruption can also be retained resulting in ageing, reduced organ function or diseases that often follow. Recently a man escaped his genetic predisposition, to becoming a victim of Alzheimer's disease, illustrating how far we are from understanding even the most well studied conditions. 

Active or passive, mobile Transposable Elements (TE) represent around 40-50% of the human genome and around 30% are found in the non-coding introns of genes. The first intron is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Our understanding of non-coding RNA (ncRNA) suggests one of its primary functions is the restraint of mobile TE's. Several species of ncRNA are associated with this restraint and genomic stability, most contain p53 binding sites that are also known to be involved in tumor suppression. 



Of the short ncRNA species, LINE-1 (L1), siRNAs are typically 21-23 nucleotides long and play a role in silencing L1 transcripts, thus preventing retro-transposition. p53 binds the L1 promoter to restrict autonomous copies of these mobile elements in human cells. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome. As little as 0.7% sequence divergence resulted in a significant reduction in recombination after double stranded breaks. piRNAs, usually 26-31 nucleotides, derived from Alu repeats restrain transposable elements. Endogenous Retroviruses (ERVs) can give rise to microRNAs (miRNAs) of 22 nucleotides, that can regulate the expression of ERV sequences and other cellular genes.  

TE's serve as templates for the generation of p53- binding-sites on a genome-wide scale . The formation of the p53 binding motifs was facilitated via methylation and deamination that distributes  p53-binding sites and recruits new target genes to its regulatory network in a species-specific manner. This p53 mechanism conducts genomic restraint, where instability and loss or mutation of p53 are commonly associated with hallmark's of cancer. 

Through a novel piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in Natural Killer (NK) cell lineage that may be broadly used in orchestrating immune development. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate NK cells are unable to express RAGs or RAG endonuclease activity during ontogeny. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors mark functionally distinct subsets of NK cells in the periphery, a surprising and novel role for RAG in the functional specialization of the NK cell lineage. 

The p53 C-terminal including amino acids 360-393 of the full-length protein locate to the mitochondrial permeability transition pore and facilitate apoptosis. However fragments of p53 at amino acid 1-186 and 22-186 drive the most mitochondrial depolarization. Crystal structures demonstrate amino acid 239 binds 106 and 241 binds 105 for one p53 unit and 243 binds 103-264-265 for a second unit, which are both are required to bind BCL-xl for apoptosis.

p53 regulates the expression of major histocompatibility complex (MHC) class I on cell surfaces. p53 peptides presented on HLA/MHC-I could attract immune surveillance as in the target-specific antitumor effects of p53 amino acids at positions 264-272, epitope 264scTCR with IL-2 on p53+/HLA-A2.1+ tumors that are primarily mediated by NK cells.  

Initially, NK cells might be activated due to the combined effect of reduced inhibition (due to decreased KIR3DL1) and increased activation signals from p53 epitopes. This NK cell activation could lead to the release of cytokines that not only enhance further NK activity but also attract and activate T cells. 

To summarize, p53 can influence both the presentation of its antigens through MHC-I and the regulation of NK cell inhibitory receptors like KIR3DL1 via piRNA. This could lead to a more effective immune response against cells with compromised p53 function, although the exact dynamics would depend on the specific context of cancer development, immune cell status, and individual genetic variations.

Sunday, January 28, 2024

All Roads Lead to (Ch)Romosome 19!


A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

Tuesday, October 10, 2023

Cancer's HLA-G Backdoor


piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.



Saturday, August 19, 2023

Can Ancient Pathways Defeat Cancer?



It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 





Wednesday, May 17, 2023

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective.