P53 - Stability and Life Or Disorder and Death!

Chromosomal stability is central to good health, but the push and shove war of genesis, division, transcription, replication and restraint can promote disorder. Disruption can also be retained resulting in ageing, reduced organ function or diseases that often follow. Recently a man escaped his genetic predisposition, to becoming a victim of Alzheimer's disease, illustrating how far we are from understanding even the most well studied conditions. 

Active or passive, mobile Transposable Elements (TE) represent around 40-50% of the human genome and around 30% are found in the non-coding introns of genes. The first intron is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Our understanding of non-coding RNA (ncRNA) suggests one of its primary functions is the restraint of mobile TE's. Several species of ncRNA are associated with this restraint and genomic stability, most contain p53 binding sites that are also known to be involved in tumor suppression. 

Of the short ncRNA species, LINE-1 (L1), siRNAs are typically 21-23 nucleotides long and play a role in silencing L1 transcripts, thus preventing retro-transposition. p53 binds the L1 promoter to restrict autonomous copies of these mobile elements in human cells. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome. As little as 0.7% sequence divergence resulted in a significant reduction in recombination after double stranded breaks. piRNAs, usually 26-31 nucleotides, derived from Alu repeats restrain transposable elements. Endogenous Retroviruses (ERVs) can give rise to microRNAs (miRNAs) of 22 nucleotides, that can regulate the expression of ERV sequences and other cellular genes.  

TE's serve as templates for the generation of p53- binding-sites on a genome-wide scale . The formation of the p53 binding motifs was facilitated via methylation and deamination that distributes  p53-binding sites and recruits new target genes to its regulatory network in a species-specific manner. This p53 mechanism conducts genomic restraint, where instability and loss or mutation of p53 are commonly associated with hallmark's of cancer. 

Through a novel piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in Natural Killer (NK) cell lineage that may be broadly used in orchestrating immune development. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate NK cells are unable to express RAGs or RAG endonuclease activity during ontogeny. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors mark functionally distinct subsets of NK cells in the periphery, a surprising and novel role for RAG in the functional specialization of the NK cell lineage. 

The p53 C-terminal including amino acids 360-393 of the full-length protein locate to the mitochondrial permeability transition pore and facilitate apoptosis. However fragments of p53 at amino acid 1-186 and 22-186 drive the most mitochondrial depolarization. Crystal structures demonstrate amino acid 239 binds 106 and 241 binds 105 for one p53 unit and 243 binds 103-264-265 for a second unit, which are both are required to bind BCL-xl for apoptosis.

p53 regulates the expression of major histocompatibility complex (MHC) class I on cell surfaces. p53 peptides presented on HLA/MHC-I could attract immune surveillance as in the target-specific antitumor effects of p53 amino acids at positions 264-272, epitope 264scTCR with IL-2 on p53+/HLA-A2.1+ tumors that are primarily mediated by NK cells.  

Initially, NK cells might be activated due to the combined effect of reduced inhibition (due to decreased KIR3DL1) and increased activation signals from p53 epitopes. This NK cell activation could lead to the release of cytokines that not only enhance further NK activity but also attract and activate T cells. 

To summarize, p53 can influence both the presentation of its antigens through MHC-I and the regulation of NK cell inhibitory receptors like KIR3DL1 via piRNA. This could lead to a more effective immune response against cells with compromised p53 function, although the exact dynamics would depend on the specific context of cancer development, immune cell status, and individual genetic variations.

All Roads Lead to (Ch)Romosome 19!

A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

A pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure. 

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

Cancer's HLA-G Backdoor

piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Educating Perfect Natural Killers

Mining Tissue Match for Immune Co-culture

Mutant p53 knockdown in KPC (pancreatic ductal adenocarcinoma) cells of immune deficient mice had no effect on primary tumor growth, by contrast the reduced tumor growth in the immune-proficient syngeneic host was due to altered immune cell recruitment.

In vivo, the increased production of pro-inflammatory cytokines coupled with increased Natural Killer (NK) cell ligand expression permits the recruitment of immune cells and clearance of abnormal cells. Elimination of senescent tumors by NK cells may occur as a result of the cooperation of signals associated with p53 expression or senescence, which regulate NK cell recruitment, and other signals that induce NKG2D ligand expression on tumor cells.

Coculture of wild-type (wt) p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. Taken together findings define the involvement of p53 in the regulation of specific NKG2D ligands that enhance NK cell–mediated target recognition.

Inhibitory KIR-educated NK cells showed significantly increased expression of the glucose transporter Glut1 in comparison to NKG2A-educated or uneducated NK cells, with and without exposure to target cells. Educated NK cells displayed significantly higher rates of cellular glycolysis than uneducated NK cells indicating they may reside in different metabolic states prior to activation. The ability to metabolize glucose may represent a mechanism for the superior functionality of educated NK cells expressing KIR receptors. 

Cancer cells acquire immunoediting abilities by which they evade surveillance and escape eradication. Murine p53 missense mutation G242A (human G245A) suppresses activation of host NK cells, enabling breast cancer cells to avoid immune assault. Serial injection of EMT6 breast cancer cells that carry wild-type (wt) Trp53 promoted NK activity, while SVTneg2 cells carrying Trp53 G242A+/+ mutation decreased NK cell numbers and increased CD8+ T lymphocyte numbers in spleen. Upon co-culture with isolated NK cells, EMT6 cells activated NK cells and proliferation, increasing interferon-gamma (IFN-γ) production; however, SVTneg2 cells suppressed NK cell activation. p53 can modulate expression by cancer cells of Mult-1 and H60a activating and inhibitory ligands for NKG2D receptors of NK cells, respectively, to enhance immune surveillance against cancer. p53 is requisite for NK cell-based immune recognition and elimination of cancerous cells, and p53 missense mutant in cancer cells impairs NK cell responses.

NK cells are the oldest member of the innate lymphoid cell family (ILC) and the only representative of cytotoxic ILCs. These tissue-resident innate immune cells have a similar functional diversity to T cells including lineage-specifying transcription factors that drive certain effector programs. ILCs are present in almost every tissue, but strongly enriched at barrier surfaces, where they regulate immunity to infection, chronic inflammation, and tissue maintenance. ILCs orchestrate tissue homeostasis through their ability to sustain bidirectional interactions with epithelial cells, neurons, stromal cells, adipocytes, and many other tissue-resident cells. ILCs provide an integrated view on how immune responses in tissues are synchronized with functional relevance far beyond the classical view of the role of the immune system in discrimination between self/non-self and host defense.

Codondex has evidenced p53 genetic variations, in multiple samples of same biopsy tissue from pancreatic tumors and oral squamous cell carcinoma's that may distinguish host tumor tissue gradients. The effect of highly-specific tissue-selected cell co-culture to educate ILC/NK cells may enhance the prospect for tissue penetration by these expanded, activated cytotoxic cells to improve overall survival.  

Expanding Treatment Horizons

An unrecognized link between p53 function and the immunosurveillance of cancer and infection led to an understanding how p53 influences the expression of MHC molecules at the cell surface via binding interaction with endoplasmic reticulum ERAP1.

Targeted mutations in multiple cancers revealed TP53 gene expression ranged between the 89th and 100th percentile of all expressed transcripts, and raised the possibility that p53 peptides arising from these common mutations might be immunogenic in these patients.

Select KIR-HLA composition favoring antitumor activity could be a promising immunotherapeutic strategy against breast cancer using autologous activated Natural Killer (NK) cell clones. Coexistence of inhibitory and activating killer-cell immunoglobulin-like receptors (KIR) to the same cognate HLA-C2 and HLA-Bw4 ligands conferred breast cancer risk. Inhibitory KIR(iKIR)-HLA pairs without their activating KIR (aKIR)-HLA counterparts were significantly higher in normal controls. Contrarily and adding complexity this suggests NK cells expressing iKIR, to cognate HLA-ligands in the absence of specific aKIR counterparts are instrumental in antitumor response. 

Identification and characterization of the peptides presented by HLA-C, G and E molecules has been lacking behind the more abundant HLA-A and HLA-B gene products. The peptide specificities of these HLA molecules were elucidated using a comprehensive analysis of naturally presented peptides. The 15 most frequently expressed HLA-C alleles as well as HLA-E*01:01 and HLA-G*01:01 were transfected into lymphoblastoid C1R B-cells expressing low endogenous HLA. 

The results (above) include allotype C*02:02 for p53 presentation and indicate the overlap of HLA source protein and top 500 peptides demonstrating the enormous complexity for multivariate analysis of immune response. However,  C*02:02 and C*05:01 have identical contact residues for p8 and p9, the residues of the bound peptide that influences HLA-C interaction with KIR. This suggests peptide effects could contribute to the broader and stronger binding reactions of these two HLA-C allotypes. Interestingly SART3 and MAGEA3 proteins both interact through the p53 pathway and are reported in the peptide study (above) in addition to TP53 to present ligands on C*02:02 and C*05:01. 

Moreover, in vitro  models demonstrated that p53 is required for upregulation of NK ligands. Further, there was a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma (BCC), with a higher likelihood that KIR B carriers harbor abnormal p53 (p<0.004). Together the data suggests functional interactions between KIR and HLA modify risks of BCC and Squamous Cell Carcinoma and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors.

Notwithstanding the enormous complexity between iKIR, aKIR - HLA interactions, immunoterapy must address the highly specific characteristics of autologous precision and discover methods to sensitively educate NK cells so that minimally invasive treatments can be extended to patients who fall outside the patient cohort for strictly regulated treatments. 

Of course, its never that simple...

Blood Pressure, Immunity and p53 Checkpoint.

Background

A few chromosome 19 curiosities developed into a deep-dive after looking into the primordial immune complex, the origins of MHC Class I and antigen receptors as revealed by comparative genomics. And the plot thickened because repressors (of endogenous retroviruses) that gained their binding affinity to retrovirus sequences at the same time their targets invaded the human lineage are preferentially located on chromosome 19. Further, the deletion rate in Zinc Finger clusters (ZNF) located around 19p.12 and 19q13.42, particularly between 51,012,739 and 55,620,741 are about twofold higher than the background deletion rate. A lot going on at this very active location which motivated this article.

At 19q13.42 kallikrein related peptidase (KLK’s), leukocyte immunoglobulin-like receptors (LILR’s) including killer-cell immunoglobulin-like receptor (KIR’s) as well MYADM, an important blood pressure related gene may also provide some clues to immunity variables that originate from or are influenced by this volatile region.

The retrotransposon bombardment of 19q13.42 and double background deletion rate is a significant remnant. However, after evolutionary MHC changed chromosomes ZNF, and within its range the chromosome 19 miRNA cluster (C19MC - 53,671,968 and 54,264,387) were still subjected to the deleterious effect of transposons. Regardless, suppression mechanics have kept epigenetic, regulatory and transcription processes, across gene’s far and wide on the move at a relatively stable rates. For example, reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues, but the effects of suppression may be sufficient to illicit a more permanent natural defense. In any event insertions and DNA damage are closely related and associated with loss of p53 that results in centrosome amplification. 

As cells pass through epithelial to mesenchymal transition (EMT), DNA damage prevents the normal reduction of p53 levels diverting the transcriptional program toward mesoderm without induction of an apoptotic response. In contrast, TP53-deficient cells differentiate to endoderm with high efficiency after DNA damage, suggesting that p53 enforces a “differentiation checkpoint” in early endoderm differentiation that alters cell fate in response to DNA damage.

Reproduction, Blood Pressure and NK

In reproduction, some of the 59 known miRNAs from primate-specific C19MC are highly expressed in human placentas and in the serum of pregnant women. They are also packaged into extracellular vesicles of diverse sizes, including exosomes and endow non-trophoblast cells with resistance to a variety of viruses. At least miR-517a-3p (a C19MC from fetal placenta) was incorporated into maternal NK cells in the third trimester, and it was rapidly cleared after delivery. miRNA's regulate the migration of human trophoblasts and suppress EMT genes critical for maintaining the epithelial cytotrophoblasts stem cell phenotype. 

Maternal uterine or decidual Natural Killer cells (dNK) express AT1, AT2, ANP, proteins of Renin Angiotensin System (RAS) suggesting dNK have the potential to contribute to changes in blood pressure that occur between days 5 and 12 of pregnancy in mice. And, pressure related mechanical stretch on endothelial cells interconnects innate and adaptive immune response in hypertension.

Pressure variables in cells and tissues may result from infection, inflammation and membrane stretch, including inner mitochondrial membrane that affects electron transport chain, endoplasmic reticulum, antigen production, presentation and exosome bound p53 / miRNA release.  ANP colocalization to dNK’s suggests that dNK RAS, at day 12 infers a localized RAS related responsiveness. STAT3 in monocytes was activated by increased endothelial stretch and is involved in driving almost all of the pathways that control NK cytolytic activity as well as the reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis and cisplatin resistance via the Slug/MAPK/PI3K/AKT-mediated regulation of EMT and autophagy.

Educating NK Subsets 

Looking into some of the ~15 genes scattered among C19MC (~sixty miRNA's) between 53,671,968 and 54,264,387;

1. MYADM was one of two blood pressure signature genes (copper uptake protein the other) differentially expressed for systolic, diastolic blood pressure and hypertension. Of the ~35 identified genes, several more strongly related to immune cell functions including PRF1, GNLY, TAGAP, IL2RB, GZMB and CD97, NKG7, CLC that are located on chromosome 19. The endothelium maintains a barrier between blood and tissue that becomes more permeable during inflammation. MYADM controls endothelial barrier function through ezrin, radixin, and moesin dependent regulation of ICAM-1 expression an essential receptor for NK interaction.

2. PRPF31 is recruited to introns following the attachment of U4 and U6 (spliceosome) RNA’s. Experiments using PRPF31 determined p53 activation is a general consequence of interfering with the spliceosome. 

3. At 54,617,158 LILRB1 receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. LILRB1 has a polymorphic regulatory region that enhances transcription in NK Cells and recruits zinc finger protein YY1 that inhibits p53. It also educates expanded human NK cells and defines a unique antitumor NK cell subset with potent antibody-dependent cellular cytotoxicity.

Monocyte/macrophage immunoglobulin-like receptors (MIR) genes are closely linked to the KIR gene family and the gene for FcαR at 19q13.4. The linkage was discovered in 1997 when a mouse sequence related to MIR mapped to a region on chromosome 7 syntenic with human 19q13.4. In 2012 a cluster of genetic loci, from multiple mouse strains and across anatomical sites was found to jointly contribute to the development of both thymic and splenic invariant natural killer T-cell NKT-cell levels. The dominant cluster was on mouse chromosome 7 and included almost all the non-C19MC genes located within the human C19MC region:– MYADM, CACNG7, VSTM1, TARM1, PRKCC(G), TFPT, NDUFA3, CNOT3, LENG1, TSEN34, RPS9. 

Four of nineteen knockout genes, that enhanced NK cell function were on chromosome 19 including GSK3 that phosphorylates Mdm2 to regulate p53 abundance, which would contribute to NK enhancement. 

A study of MHC disassortative mating in humans found Israeli’s were more gene similar, but MHC dissimilar than Europeans who were gene dissimilar and MHC dissimilar . Now, a recent study in American Indians found remarkably low KIR and HLA diversity in Amerindians that revealed signatures of strong purifying selection shaping the centromeric KIR region. This narrows to the importance of LILR-KIR region on chromosome19 that codes for the strongest NK cell educator receptors.

p53 regulates exosomes and miRNA’s directly influence NK responsiveness including regulation of dNK during pregnancy. Exosomes regulated by p53 also transfer it and can suppress growth and proliferation of p53 negative cells. Further, miRNA’s, induced by p53 can directly target ULBP2 mRNA and reduce its cell-surface expression.

Disease highlights

 

rs78378222 polymorphism in the 3'-untranslated region of TP53 contributes to development of age-associated cataracts by modifying miRNA-125b-induced apoptosis of lens epithelial cells. miRNA-125b is a novel negative regulator of p53. Deleting PRPF31 activates the p53 pathway and triggers retinal progenitor cells apoptosis. The members of the miR-125 family (miR-125a on chromosome 19q13.4 and miR-125b on chromosome 21q21.1) reside in two distinct human miRNA clusters with the let-7 and miR-99 families and these miRNAs are thus likely co-transcribed.

  

More succinctly, NK cells are alerted to induction of p53 in cancer cells by upregulation of the NKG2D ligands ULBP1 and ULBP2. p53 also induces expression of miR-34a and miR-34c, which target ULBP2 mRNA for destabilization. Observations suggest two possibly contrasting roles for p53 in NKG2DL expression and requires more investigation into how the regulation is fine-tuned. Extending this model to human populations would suggest that p53 must be inactivated among those with a robust NK response (those with B haplotypes). 

Taken together, our data suggest functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinoma, and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors. 

Conclusion

The convergence of several important cellular mechanisms that point back to a 19q13.42 address may illustrate ancient and conserved elements that perpetuate and function as integrated biological units effecting blood pressure, reproduction and immunity. Many of these impart education to innate immunity.

IFN-γ Concentration, p53 and Immune Sensitivity

IFN-γ 

Dimorphic complexity between Human Leukocyte Antigen (HLA) and Killer Immune Receptor (KIR) haplotypes introduce significant challenges for personalized Natural Killer (NK) and immune cell therapy. In vitro models support a p53 requirement for upregulation of NK ligands and there is a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma's (BCC) with a higher likelihood that KIR B carriers harbor abnormal p53. Data suggests that KIR encoded by B genes provides selective pressure for altered p53 in, at least BCC's. 

Breast cancer (BC) patients exhibit reduced NK-cytotoxicity in peripheral blood. To test whether certain KIR-HLA combinations impair NK-cytotoxicity that predispose to BC risk, KIR and HLA polymorphisms were analyzed in 162 women with BC and 278 controls. KIR-B genotypes increased significantly in BC. Certain activating KIR (aKIR) HLA ligand combinations were significantly increased in advanced-BC patients whose combinations also shared specific inhibitory KIR (iKIR) counterparts. Contrarily, iKIR-HLA pairs without their aKIR-HLA counterparts were significantly higher in controls. The data suggests NK cells expressing iKIR to cognate HLA-ligands in the absence of specific aKIR counterpart are instrumental in antitumor response. 

The TP53 family consists of three sets of transcription factor genes, TP53, TP63 and TP73, each expresses multiple RNA variants and protein isoforms. TP53 is mutated in 25-30% of BC's, but the effect of isoforms in BC is unknown. Predicted changes in expression of a subset of RNAs involved in IFN-γ signaling were confirmed in vitro. Data showed that different members of the TP53 family can drive transcription of genes involved in IFN-γ signaling in different BC subgroups. Moreover, tumors with low IFN-γ signaling were associated with significantly poorer patient outcome.

NK receptor NKG2D interacts with several virus or stress inducible ligands, including ULBP1 (NKG2DL1) and -2 expressed on target cells. Induction of wild-type p53, but not mutant p53, strongly upregulated mRNA and surface expression of ULBP1 and -2, but not other ligands. An intronic p53-responsive element was discovered in these genes. Coculture of wild-type, p53-induced human tumor cells with primary human NK cells enhanced NKG2D dependent degranulation and IFN-γ production by NK cells.  

In the Tumor Micro Environment (TME) IFN-γ is produced at various concentrations in response to numerous immune stimulants and highlights the need for more personalized, disease centric approach. Engagement of IFN-γ Receptor on distinct tumor stromal cells, induction of interferon stimulated genes, immune status of the TME, and IFN-γ concentration are recognized as critical determinants for IFN-γ-mediated outcomes. Notably, an appropriate antitumor concentration of IFN-γ has yet to be determined. Interestingly IFN-γ produced by NK cells is said to be an essential mediator of Angiotensin II inflammation and vascular dysfunction.

Pharmacological activation of p53 exerts a potent antileukemia effect on antitumor immunity, including NK cell-mediated cytotoxicity against acute myeloid leukemia (AML). Interestingly, orally administered DS-5272 (a potent inhibitor of MDM2 - promotor of p53 degradation) induced upregulation of CD107a and IFN-γ in NK cells but not in CD8+ T cells. Furthermore, coculture of NK cells with leukemia cells resulted in massive apoptosis. 

Findings strongly suggest an interaction between B7 (NK receptor) molecules contribute to a particular design of the inflammatory microenvironment including B7-H6 and PD-L1, for which therapy was enhanced by expanded NK autologous or donor cells. RNA transfections, into HeLa cells of p53 or BRCA1 intron1 Key Sequences (based on Codondex iScore's most significant mRNA-intron1 variations) caused several genes to be upregulated, +1500% above control including B7-H6 (NCR3LG1) ligand for NCR3 (Nkp30) NK cell receptor which, when engaged triggers IFN-γ release. NCR3 and soluble isoforms of Leukocyte Specific Transcript 1 may play a role in inflammatory and infectious diseases. 

Blockade of B7-H3 prolonged the survival of SKOV3 ovarian cancer cell, an in ovarian tumor-bearing mice, miR-29c improved the anti-tumor efficacy of NK-cell by directly targeting B7-H3. miR-29c downregulates B7-H3 and inhibits NK-cell exhaustion. Low levels of mir-29c have been associated with mutated p53 in BC patients. miR-29 miRNAs activate p53 by targeting p85α and CDC42 and upregulate p53 levels that induce apoptosis in a p53-dependent manner. miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting IFN-γ. 

Besides (intron predominant) human ALU repeats, reverse complementary sequences between introns bracketing circRNAs are highly enriched in RNA editing or hyper-editing events. Knockdown of double stranded RNA-editing enzyme - ADAR1 significantly and specifically upregulated circRNA expression. In its absence (interferon stimulating) oligoadenylate synthetase (OAS) can be activated by self-dsRNA (in contrast to viral dsRNA), resulting in RNase L activity and cell death. Conversely, OASL1 expression enhanced RIG-I-mediated IFN induction. In cells absent of p53, immunogenic, endogenous mitochondrial dsRNA are produced and processed by the OAS/RNase L system presenting a novel mechanism in diseases with aberrant immune responses. IFN-γ restores the impaired function of RNase L and induces mitochondria-mediated apoptosis in lung cancer. The p53—OAS axis, in mitochondrial RNA processing may prevent self-nucleic acid such as dsRNA from aberrantly activating innate immune responses.

A plethora of evidence supports bottom up approach to personalized therapy. A p53 intron1-mRNA regulatory loop, as a potential mechanism in IFN responses to infection and disease may be diagnostic. Pre-clinical research, presently underway will establish whether p53 is diagnostic for specific selections of a biopsy to educate NK cells and trigger effective immune response.

Custom Immunotherapy To Address Dimorphic Complexities.

Dimorphic relationships between genes on Chromosome (Chr)6, encoding Human Leukocyte Antigens (HLA) and those on Chr19, encoding Killer-cell immunoglobulin-like receptors (KIRs) may eventually uncover important information as to how, why and when Natural Killer (NK) cells determine self restraint or attack cells infected by pathogens and disease. These proteins emerge from their respective zones, on each chromosome that have and continue to be subject to frequent recombination events.

The active region of Chr19 has a long history of recombinations that have and continue to define the expression patterns of telomeric and centromeric proportions of KIR gene's encoding receptors that bind cells presenting MHC class 1, HLA haplotype combinations that vary significantly across tissues in different population groups. Adding complexity, HLA genes on Chr6 are also subject to significant recombination making the dimorphic functional HLA-KIR interactions difficult to predict. 

Studies across population groups reveal the great diversity of HLA-KIR dimorphisms. The Southern Han centromeric KIR region encodes strong, conserved, inhibitory HLA-C-specific receptors, and the telomeric region provides a high number and diversity of inhibitory HLA-A and -B-specific receptors. In all these characteristics, the Chinese Southern Han represent other East Asians, whose NK cell repertoires are thus enhanced in quantity, diversity, and effector strength, likely augmenting resistance to endemic viral infections.

One study goes much further suggesting that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered p53 in BCC tumors. This preference implicates multi-modal p53 mechanisms that are also known to upregulate NK ligands, induce HLA-A11 assembly against Epstein Bar Virus and bind a frequently mutated p53 peptide in a complex with HLA-A and presented at the cell surface that prevent T-Cell response. In support, selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

In addition to KIR, adaptive NKG2C+ NK cells display fine peptide specificity selectively to recognize HCMV strains that differed by a single substitution in the HLA-E-binding UL40-derived peptide during infection. Distinct peptides controlled the degree of proliferation in synergy with pro-inflammatory cytokines. Viral peptides are known to augment inhibition at NKG2A. Conversely, NKG2A+ NK cells sense MHC class I downregulation more efficiently than KIRs. Thus, both receptor:ligand systems appear to have complementary functions in recognizing changes in MHC class I.

Polymorphic landscapes across HLA, KIR and NKG receptor repertoires coupled with receptor:ligand haplotype cross referencing makes it near impossible to predict therapeutic targets across the breadth of disease and disease combinations that affect populations. A recent KIR-HLA co-existence study of haplotypes in Breast Cancer patients and controls highlights this complexity. 

Genetic signatures that target discovery of desired cell functionality to select preferential cells/tissues from micro environments used to educate and license autologous or allogeneic NK cells may tease specific, finely tuned, intact receptor repertoires. Once licensing efficacy is reached, expanding NK cell populations and applying them to act upon previously unrecognizable cells of a patient becomes the next frontier of immune therapy. This is the exciting work presently being undertaken by researchers and staff working with Precision Autology using Codondex methodologies. 

A p53 Checkpoint For Cancer Therapy

Enormously complex signaling exists in the communication of antigens, receptors and ligands in DNA pathways between Natural Killer cells (NK) and target cells with which they interact. Based on observations, following NK formation of an immune synapse with its target cell two outcomes occur most often, termination or differentiation. The innate immune system comprises multiple cell types that are present and differentiated in tissues, but the predatory-like activity of NK has led to the general perception of its role in the immune system's front line.

As we have articulated many times on this blog, immunity and reproduction are tied, originally through allorecognition to the conserved p53-mdm2 axis. Further, it has become abundantly clear that auto-regulation of p53 occurs in multiple gene positive and negative feedback loops including mdm2. NK performance in young versus older patients showed a reduced capacity for, synaptic polarization and perforin release into the immune synapse before killing target cell. Further that the reduced release of perforin also reduced the capacity for NK to clear senescent cells associated with aging.

The activation of mitogen‐activated protein kinases (MAPK) is critical for lytic granule (perforin-granzyme) polarization, granule exocytosis and NK Cytotoxicity. It is possible that these proximal signalling events are compromised by aging. In addition, the studied p53 mutants regulated MAP2K3 gene whereas ectopic expression rescued the proliferative defect induced by mutant p53 knockdown.

In one series of experiments it was shown that the mutational status of p53 can facilitate cytotoxicity and different T cell recognition patterns. The p53 protein is presented by MHC molecules and the differential T cell recognition patterns seem confined to p53 as an antigen. The paper suggests p53 may behave differently to other classical tumor antigens, therefore a biomarker for immunotherapy targeting p53 should be the type of mutation expressed rather than protein levels only.

As previously reported, cytoskeleton superfamily member Talin1 has been uniquely tied to two essential NK functions;  activation of LFA1, required for binding ICAM on NK target cell and NK polarization that results. We know overexpression of talin head activates LFA1 and talin1 promotes cell proliferation by affecting the expression of BCL2 family and p53 network. But, mdm2 the conserved nemesis of p53 is neutralized by Merlin, another cytoskeleton superfamily protein also required for polarization. p53 also regulates the highly conserved Cdc42 which effects adhesion, actin cytoskeletal dynamics and cell movement including for angiogenesis in developing tumor microenvironments.

We found that activation of p53 augmented NK cell-mediated cytolysis of tumor cells via induction of ULBP2 expression on tumor cell surface. Further, we identified p53 as a direct transcriptional regulator of ULBP2 via an intron1 binding site, thus revealing previously unknown molecular mechanism controlling NKG2D ligand transcription. In mouse NK cells, talin is required for outside signaling by LFA1, which together with signaling by NKG2D induces granule polarization.

The functions of p53 are inextricably linked to multiple mechanisms in NK and target cells including recognition, antigen-receptor-ligand binding, cytoskeletal rearrangement, immune synapse, granzyme and perforin release. p53's mutation frequency and variances bearing p53 destabilizing mutations are recognized more effectively by p53-specific T cells than stabilized p53 mutants. Therefore, NK could operate its probe as a binding cipher that determines whether its target can be killed. Variable binding, and ectopic expression, resulting from a p53 feedback loop could be dependent on a p53 variable-kill-checkpoint that triggers the cascade of coordinated activities between NK and its target, generally referenced in the preceding paragraphs.

NK's p53 status, a targets MHC molecules presenting p53 antigens, ULBP2-NKG2D binding and relevant pathways confer with observations that the period of NK engagement is sufficient to allow downstream DNA transcription and translation to confirm and enable the kill event. Co-culture methods that could educate NK to better synchronize with targets, based on p53 status may usher in new regimes for organic immunotherapy. The Codondex research teams at Precision Autology are progressing through pre-clinical research using their computed cell selections.

Hope for a p53 Autologous Natural Killer Cell Therapy

Natural Killer Cells (NK) are much more than cell killers! They possess mechanisms and sensitivities that, among many functions, enables them at the front line of reproduction to interact with incoming trophoblasts that invade the uterine wall where NK cells are critical for blastocyst implantation and pregnancy. NK are members of the innate immune system, but they can be licensed to kill and re-purpose cells whereas most innate immune cells directly target invading pathogens.

Maternal decicdual NK may be redirected by PreImplantation Factor (PIF) expressing, anti-apoptopic, extra-villous trophoblasts that invade the endometrium (epithelioid) of the decidua of the uterine wall. This may result from epithelial LIF expression, and LIFR(eceptors) critical for blastocyst implantation. LIF allele's may act as a NK switch, the direct result of a p53 promoter allele that targets specific LIF transcription, that alters NK interactions with trophoblasts, the host endometria and vascular epithelia. If so, redirection of NK is an essential mechanism of conception that underwrites the development of the placenta.

Studies have revealed p53 targets LIF and demonstrated that, as a secreted protein LIF can function through the Stat3/ID1/MDM2 pathway to negatively regulate p53. Selected alleles in SNPs in LIF, Mdm2, Mdm4, and Hausp genes, each of which regulates p53 levels in cells, are also enriched in IVF patients. This association of SNPs in the p53 pathway with human fertility strongly suggests that p53 regulates human reproduction. It is distinctly possible enriched SNP's invoke regulation that negatively affects p53 and may also be the mechanism by which NK switches between modes that kill or transform its cell targets. In implantation, levels of p53  may lead to pre-eclampsia a condition that is the direct result of increased, p53 dependent apoptosis in extra-villous trophoblasts.

Pathogen-associated molecular pattern–mediated metabolic reprogramming can be considered as a manifestation of innate immune signaling, reprogramming a conserved phenomenon, that changes how we think about the biology and function of the innate immune network.

The mode of NK, in response to cancers may determine the fate of its target either by the binding of innate receptor combinations that initiate an immune synapse and perforin-mediated cytolysis or the release cytokines and chemokines that alters the inflammatory response. It was recently demonstrated these combinations are varied by different tissue and disease depending on p53 for example, in lung adenocarcinoma NK limited target killing and reduced inflammatory response allowing the cancer to spread. Further, peptides derived from p53 are presented by class I MHC molecules and may act as tumor-associated epitopes which could also be targeted by p53-specific T cells.  Results show that selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

These complex tissue dependent modes, through p53 pathways that contribute negative or positive feedback loop's, have prevented the most mutated gene in cancer from itself becoming a target of drug or immune therapy. Using a novel approach Precision Autology's Codondex algorithm computed the variable state of p53 isoforms, using a relative vector distance, from the consensus, to select patient cells for co-culture with, at least autologous NK for use in customized therapy. The approach will enable approved labs to identify highly specific cell targets, in part by their p53 state and to educate autologous NK cells based on a single p53 measure so that NK precision can be calibrated via the mismatch of target receptor combinations and p53.