p53 Direct Mechanisms In Immunity

Never in the field of molecular oncology have so many sites of posttranslational modification in one protein (p53) been modified by so many different enzymes, but direct response mechanisms that increase immune receptors are rarely discovered and have important implications.  

In the tumor microenvironment (TME), cancer associated fibroblasts (CAFs) display an activated phenotype and can physically remodel the extracellular matrix (ECM). Silencing p53 in the CAFs strongly compromised this activity, implicating p53 as a key contributor to a distinctive CAF feature. Here, the non-autonomous, tumor-suppressive activity of non-mutant p53 cDNA is rewired to become a significant contributor to the CAFs’ tumor-supportive activities. This surprising role for p53 in CAFs suggests that, during tumor progression p53 functionality is altered, not only in the cancer cells, but also in their adjacent stroma.

Although p53 is not mutated in the human placenta, it has become functionally incompetent. Why and how p53 is functionally incompetent in cytotrophoblast cells might well be the key to understanding trophoblast invasion. Vascular remodeling for placentation is controlled by small populations of conventional Natural Killer cells, distinct from much larger populations of uterine NK cells, that acidify the ECM with a2V-ATPase, that activates MMP9, degrades the ECM and releases stored pro-angiogenesis growth factors. Similarly hypoxic TME's that in NK cells sustain excessive mitochondrial fission resulting in fragmentation could cause a2V-ATP activated MMP9 to similarly degrade ECM and promote angiogenesis in the early TME.  

Another MMP protein, MMP2 is a ligand for the Toll-like receptor 2 (Tlr2). Expression of Tlr2 and Tlr4 in the TME is important for the promotion of tumor growth, and when both of these receptors are absent, growth is compromised. Furthermore, the expression of Tlr2 and Tlr4 in both hematopoietic and stromal compartments appears to support MMP2-driven tumor growth.

The integration of the TLR gene family into the p53 regulatory network is unique to primates. p53 promoter response elements that are targeted by this DNA damage and stress-responsive regulator suggest a general p53 role in the control of human TLR gene expression. TLR genes show responses to DNA damage, and most are p53-mediated. TLR's mediate innate immunity to a wide variety of threats through recognition of conserved pathogen-associated molecular motifs. Expression of all TLR genes, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors with considerable inter-individual variability. Most TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites.

A polymorphism in a TLR8 response element provided the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings—demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress—have many implications for health and disease, as well as for understanding the evolution of DNA damage and p53 responsive networks. That p53 can directly increase an inflammatory response differs from the generally held view relating to the antagonistic affect of p53 on inflammation directed by NF-κB. However, the direct mechanism here is different in that it involves another p53-mediated increase in a receptor that translates ligand interactions into cytokine responses.

p53 Convergence and Immunity

Renewed interest in Bradykinin and its inactivation, by Angiotensin Converting Enzyme (ACE), during Covid infection reconfirmed RAS and KKS (Kallikrein-Kinin, Bradykinin) as the major systems of vasodilation and constriction contributing to blood pressure and disease. ACE2, a molecule of focus in Covid, reduces the Bradykinin product des-Arg9 bradykinin to inactive metabolites.

In pre-eclampsia reduced Kallikrein (KLK) generation and Bradykinin's activation, via its BK1 and BK2 receptor, modulates stress response through NF-κB and p53 pathways. These are the major cellular stress response pathways that promote or oppose apoptosis and influence cell fate. Two functionally divergent p53-responsive elements were discovered in the rat BK2 receptor promoter, which interact with ACE, play a significant role regulating vascular tone and blood pressure and in the cross-talk between RAS and KKS. 

In uterine immune cells RAS proteins AT1, AT2, and ANP are expressed and ANP co-localizes to uterine Natural Killer (uNK) cells between pregnancy day 10 and 12, immediately before spiral arterial modification. In mice this suggested that uNK contributes to the physiological changes in blood pressure between days 5 and 12.

During the first trimester the uNK cells dramatically increase, from around 15% to 70% of immune cells in the Decidua of the Uterus. Expressed RAS-KKS proteins during this time may be solely responsible for amplified stimulation of the plasma contact system at least via p53-mediated transcription and activation of the BK2 promoter.

In myocytes stretch-mediated release of angiotensin II (AngII) induced apoptosis by activating p53 that enhanced local RAS and decreased the Bcl-2-to-Bax protein ratio in the cell. In endothelial cells mechanical stretch interconnected innate and adaptive immune response in hypertension. This suggests that mechanical forces, such as those experienced in hypertension, can influence the immune system and contribute to inflammation, vascular damage associated with high blood pressure and vascular remodeling.

MYADAM and PRPF31 were the only genes from a meta-analysis that linked diastolic, systolic blood pressure and hypertension. These are located on Chromosome 19 between 50-55,000,000 bps, which includes all Killer immunoglobulin like receptors (KIR's), Kallikrein related peptidases (KLK's) and c19MC MiRNA's, in a region characterized by a 2X background deletion rate. During different trimesters it was found that NK cells, in pre-eclampsia, directly incorporate c19MC MiRNA's that are important to placental development and their deregulation could lead to the development of pre-eclampsia. 

It adds up that the massively disproportionate uNK activity in pregnancy and its impact on the mechanics of blood pressure could amplify sensitivities for p53 mediated stress response. It’s known that uNK cells contribute to the remodeling of spiral arteries and regulation of blood pressure, which are critical for fetal development. Similarly, on a cellular scale, abnormal cell growth and expansion of NK cells, may also amplify conditions that direct NK education and licensing to support growth, as in solid tumors and micro-vascular remodeling, or trigger inflammation, through cytokine expression and/or granulocyte killing of expanded missing-self cells. 

Cancer's HLA-G Backdoor

piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.

Indispensable Mitochondria - Cancers back door?

Immediately prior to fertilization spermatozoa are devoid of Mitochondrial DNA (mtDNA), potentially explaining an aspect about selection that may serve the legacy for maternal immune tolerance. Post fertilization, on day 11-13, outermost trophoblasts of the blastocyst dock with the decidual lining as it embeds in the uterine wall. Then, maternal vascular remodeling and placental formation begin toward successful implantation. 

Higher quality trophoblasts are associated with lower mtDNA content. Moreover, euploid blastocysts with higher mtDNA content had a lower chance to implant and mtDNA replication is strictly downregulated between fertilization and the implantation. What is it about absent or reduced mtDNA that may also relate to the mechanics of immune tolerance and vascular remodeling, which are also features of solid tumors.

The initial absence or downregulation of MtDNA, may relate an immune tolerance by uterine Natural Killer (NK) cells. As mtDNA upregulates, after day 12, it may initiate NK auto-reactivity required for maternal microvascular remodeling. This auto-immune paradox is a prerequisite for vascular remodeling, which is also seen in localized hypertension, and the likely basis of successful blastocyst implantation. Acutely, micro-hypertension induced mechanical stretch, on endothelial cells, interconnects innate and adaptive immune responses. 

The dominant cell in the decidua is an NK subset (dNK), they express low levels of IFN-γ and express proteins of Renin Angiotensin System (RAS). At day 12 RAS peptide ANP colocalizes to dNK’s suggesting that dNK RAS infers localized responsiveness.  When TFAM, required for transcription of mtDNA, was deleted from cardiomyocytes, after 32 days, animals developed cardiomyopathy and Nppa (gene encoding ANP) and Nppb expression was elevated. 

In monocytes increased endothelial stretch activates STAT3, which is involved in driving almost all pathways that control NK cytolytic activity and reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis. p53, Stat3, and, potentially, the estrogen receptor are thought to act as co-regulators, affecting mitochondrial gene expression through protein-protein interactions. Co-immunoprecipitation of p53 with TFAM suggests it may regulate mitochondrial DNA-damage repair.

Like initial trophoblasts with low level mtDNA, mature cells, like cardiomyocytes that prolong low level mtDNA may also aggravate autoimmune sponsored hypertension that remodels microvascular networks providing nutrients for growth of reduced mtDNA stem cell replicas. Indeed, mitochondrial dysfunction (from depleted mtDNA) does not affect pluripotent gene expression, but results in severe defects in lineage differentiation.

During severe sepsis, intense, on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. This may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. 

Identifying cells that optimally educate cocultured NK cells for precision IFN-γ and cytolytic responsiveness is part of the ongoing work by the Codondex team.

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

ΔΨm and Immune Responses to Disease

Each cell contains hundreds to thousands of mitochondria, each with hundreds of electron transport chain complexes (ETC) that deliver ATP as the cells primary energy source and the central dogma of eukaryote existence. ETC function's, on the inner mitochondrial membrane, are sensitive to change in electric charge represented as mitochondrial polarization and mitochondrial membrane potential (ΔΨm). The large responsive surface area of the outer and inner membrane promotes remodeling and protein interactions that may lead to cellular diseases including cancer.

Tumor Necrosis Factor (TNF) causes mitochondria to relocate, to bind the nucleus and efficiently shuttle elements that enable fast DNA transcription and signaling that, under certain conditions, may suppress the pro inflammatory immune response. TNF signaling to mitochondrial PINK1 stabilizes ubiquitin chains that result in mitochondrial relocation and shuttling activated p65 that increases NF-κB transcription in the nucleus. This anti-apoptotic response resembles the feed forward activation loop in Pink1/Parkin-dependent mitophagy as an independent defense against accumulation of dysfunctional mitochondria, that under physiological conditions integrate their roles in innate immune signaling and stress. 

Enhanced activation of NF-κB by TNF, via mutant p53, concomitantly suppressed the pro-apoptotic effect of TNF leading to increased invasiveness of cancer cells. Accordingly mutant p53 may directly affect nuclear accumulation and retention of p65 upon cytokine exposure as mutant p53 overexpression and nuclear p65 staining in tumors strongly correlated.

Stresses elicited by aneuploid states in cells mediate interaction between Natural Killer (NK) cells. In highly aneuploid cancer cell lines NF-κB signaling is upregulated and activated promoting immune clearance by NK cells, but anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Rapid NF-κB signaling may be preferentially selected because it antagonizes p53, known to inhibit the growth of highly aneuploid cells. Significantly increased mitochondrial DNA in aneuploid cells may result from increased fission of mitochondria, similar to that found in extreme ploidy during Oocyte development. Perhaps supporting the reason in embryonic stem cells (ESC) apoptosis occurs independent of p53 and protein kinase Akt3, the regulator of ESC apoptosis, suppresses p53 for the survival and proliferation of these stem cells.

A comprehensive metabolic analysis identified mitochondrial polarization as a gatekeeper of NK cell priming, activation, and function. Mitochondrial fusion and OXPHOS promote long-term persistence and improve cytokine production by NK cells. Hypoxic Tumor Micro Environments (TME) sustained NK cell activation of mTOR-Drp1, which resulted in excessive mitochondrial fission and fragmentation. Inhibition of fragmentation improved mitochondrial metabolism, survival and the antitumor capacity of NK cells. 

Mitochondrial biogenesis also requires the initiation of Drp1-driven fission. Whereas, fissions from dysfunction are associated with diminished ΔΨm and Reactive Oxygen Species (ROS), which are unchanged in this biogenesis. Depletion of p53 exaggerates fragmentation, but does not affect ΔΨm and ROS levels. Instead, p53 depletion activates mTORC1/4EBP1 signaling that regulates MTFP1 protein expression to govern Drp1-mediated fission. Thus, increased fission upon p53 loss can stimulate biogenesis, but not accumulation of damaged mitochondria. This may explain how mitochondrial integrity, in context of p53 deficiency induced fragmentation, may suppress immune signaling.

Downregulating p53 expression or elevating the molecular signature of mitochondrial fission correlates with aggressive tumor phenotypes and poor prognosis in cancer patients. Upon p53 loss, exaggerated fragmentation stimulates the activation of ERK1/2 signaling resulting in epithelial-to-mesenchymal transition-like changes in cell morphology, accompanied by accelerated MMP9 expression and invasive cell migration. Notably, blocking the activation of mTORC1/MTFP1/Drp1/ERK1/2 axis completely abolishes the p53 deficiency-driven cellular morphological switch, MMP9 expression, and cancer cell dissemination. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

Vascular remodeling, in the uterus, during pregnancy is controlled by small populations of conventional Natural Killer cells that acidify the extracellular matrix (ECM) with a2V-ATPase that activates MMP9, degrades the ECM and releases pro-angiogenesis growth factors stored in the ECM. Hypoxic TME's that sustain excessive mitochondrial fission-fragmentation in NK cells would cause a2V-ATP activated MMP9 to similarly promote angiogenesis akin to Blastocyst implantation.  

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for the 'canary in the mine' of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis, normal immune signaling and response through to mitochondrial biogenesis, differentiation, angiogenesis, reduced immune signaling and response. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

The delicate balance in health and sensitivity of at least TP53 DNA is known to result in DNA to DNA and/or upstream RNA/protein interactions that influence mechanics of molecules and responses to ΔΨm variations. Here we have highlighted links between NK cell function relative to  mitochondrial polarization, ΔΨm and p53 relative to mitochondrial fission and immune signaling. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Angiogenic Growth Factor Flood

A previous series, about p53 culminated with "Blastocyst Development - A Perfected Cancer Model" that focused on the parallels in angiogenesis, triggered by blastocyst implantation and progression of tumors beyond ~1mm. Now, a recent study has found that conventional Natural Killer cells (cNK) control vascular remodeling in the uterus during pregnancy by acidifying the extracellular matrix (ECM) with a2V-ATPase that activates MMP-9 that degrades the ECM. Ablation of a2V-ATPase decreases Bax and p53 expression in testis and leads to implantation failure in the female mouse. The degrading ECM releases bound pro-angiogenic growth factors that contribute to Uterine artery (UtA) remodeling characterized by the loss of vascular smooth muscle cells (VSMCs) and dilation of the vessels. Without cNK, the UtA never lose VSMCs and UtA resistance remains high often leading to implantation failure.

Its logical that a timely flood of angiogenic growth factors, previously stored in the ECM would provide instant availability, but whether this explains the maternal-embryonic immune paradox remains to be determined? In the immune paradox maternal NK cells invade and maternal blood vessels are remodeled just before the arrival of trophoblasts, the external cells of the blastocyst, that carry male antigens during formation of the fetal placenta. A sudden flood of angiogenic factors preceding invading trophoblasts could provide the perfect environment required for maternal arterial/vascular remodeling.

Lymphocytes in the uterine lining (decidua) are dominated by a unique decidual natural killer (dNK) cell population. The dNK cell surface phenotype CD56bright CD16− CD3− and macrophages CD14+ CD206+(dMac) support a model whereby dNK cells, capable of killing extra-villous cytotrophoblasts (CTB), are prevented from doing so by neighboring macrophages thus protecting the fetal cells from NK cell attack. Existing research has centered on the function of the abundant and diverse sets of dNK, but now that cNK cells have been identified to play a more significant role, our understanding of the remodeling are likely to change.

In CTB exogenous p53 is able to down-regulate MMP-9 promoter activity, but endogenous p53 is not able to regulate MMP-9 expression in first trimester CTB cells. Inactivation of p53 through mutation is the most common trait in cancer. By loosing its onco-suppressive activity, p53 becomes oncogenic in almost all malignant tumors (Soussi and Lozano, 2005). Although p53 is not mutated in the human placenta, it has become functionally incompetent. Understanding why and how p53 is functionally incompetent in CTB might well be the key to understanding trophoblast invasion.

Downregulation of EMMPRIN (BSG,CD147) by p53 leads to a decrease in the activity of MMP-9 and an inhibition of tumor cell invasion. Upregulation of EMMPRIN seen in many cancers can be attributed to, at least in part, to the dysfunction of p53 and thus provides new evidence for the roles of p53 in tumor development and progression. Epithelial derived MMP-9 exhibits a novel defensive role of tumor suppressor in colitis associated cancer by activating MMP9-Notch1-ARF-p53 axis. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

The inter-activity of p53, cNK and MMP-9 are complexed, but this novel research may lead to the mechanisms by which arterial remodeling occurs after release of angiogenic factors from ECM. If that shares characteristics of NK invasion into developing tumor micro environment's a new therapeutic approach may arise.