Pathogens And Immunity - Mutual Memories

The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 

p53 Direct Mechanisms In Immunity

Never in the field of molecular oncology have so many sites of posttranslational modification in one protein (p53) been modified by so many different enzymes, but direct response mechanisms that increase immune receptors are rarely discovered and have important implications.  

In the tumor microenvironment (TME), cancer associated fibroblasts (CAFs) display an activated phenotype and can physically remodel the extracellular matrix (ECM). Silencing p53 in the CAFs strongly compromised this activity, implicating p53 as a key contributor to a distinctive CAF feature. Here, the non-autonomous, tumor-suppressive activity of non-mutant p53 cDNA is rewired to become a significant contributor to the CAFs’ tumor-supportive activities. This surprising role for p53 in CAFs suggests that, during tumor progression p53 functionality is altered, not only in the cancer cells, but also in their adjacent stroma.

Although p53 is not mutated in the human placenta, it has become functionally incompetent. Why and how p53 is functionally incompetent in cytotrophoblast cells might well be the key to understanding trophoblast invasion. Vascular remodeling for placentation is controlled by small populations of conventional Natural Killer cells, distinct from much larger populations of uterine NK cells, that acidify the ECM with a2V-ATPase, that activates MMP9, degrades the ECM and releases stored pro-angiogenesis growth factors. Similarly hypoxic TME's that in NK cells sustain excessive mitochondrial fission resulting in fragmentation could cause a2V-ATP activated MMP9 to similarly degrade ECM and promote angiogenesis in the early TME.  

Another MMP protein, MMP2 is a ligand for the Toll-like receptor 2 (Tlr2). Expression of Tlr2 and Tlr4 in the TME is important for the promotion of tumor growth, and when both of these receptors are absent, growth is compromised. Furthermore, the expression of Tlr2 and Tlr4 in both hematopoietic and stromal compartments appears to support MMP2-driven tumor growth.

The integration of the TLR gene family into the p53 regulatory network is unique to primates. p53 promoter response elements that are targeted by this DNA damage and stress-responsive regulator suggest a general p53 role in the control of human TLR gene expression. TLR genes show responses to DNA damage, and most are p53-mediated. TLR's mediate innate immunity to a wide variety of threats through recognition of conserved pathogen-associated molecular motifs. Expression of all TLR genes, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors with considerable inter-individual variability. Most TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites.

A polymorphism in a TLR8 response element provided the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings—demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress—have many implications for health and disease, as well as for understanding the evolution of DNA damage and p53 responsive networks. That p53 can directly increase an inflammatory response differs from the generally held view relating to the antagonistic affect of p53 on inflammation directed by NF-κB. However, the direct mechanism here is different in that it involves another p53-mediated increase in a receptor that translates ligand interactions into cytokine responses.

p53 Convergence and Immunity

Renewed interest in Bradykinin and its inactivation, by Angiotensin Converting Enzyme (ACE), during Covid infection reconfirmed RAS and KKS (Kallikrein-Kinin, Bradykinin) as the major systems of vasodilation and constriction contributing to blood pressure and disease. ACE2, a molecule of focus in Covid, reduces the Bradykinin product des-Arg9 bradykinin to inactive metabolites.

In pre-eclampsia reduced Kallikrein (KLK) generation and Bradykinin's activation, via its BK1 and BK2 receptor, modulates stress response through NF-κB and p53 pathways. These are the major cellular stress response pathways that promote or oppose apoptosis and influence cell fate. Two functionally divergent p53-responsive elements were discovered in the rat BK2 receptor promoter, which interact with ACE, play a significant role regulating vascular tone and blood pressure and in the cross-talk between RAS and KKS. 

In uterine immune cells RAS proteins AT1, AT2, and ANP are expressed and ANP co-localizes to uterine Natural Killer (uNK) cells between pregnancy day 10 and 12, immediately before spiral arterial modification. In mice this suggested that uNK contributes to the physiological changes in blood pressure between days 5 and 12.

During the first trimester the uNK cells dramatically increase, from around 15% to 70% of immune cells in the Decidua of the Uterus. Expressed RAS-KKS proteins during this time may be solely responsible for amplified stimulation of the plasma contact system at least via p53-mediated transcription and activation of the BK2 promoter.

In myocytes stretch-mediated release of angiotensin II (AngII) induced apoptosis by activating p53 that enhanced local RAS and decreased the Bcl-2-to-Bax protein ratio in the cell. In endothelial cells mechanical stretch interconnected innate and adaptive immune response in hypertension. This suggests that mechanical forces, such as those experienced in hypertension, can influence the immune system and contribute to inflammation, vascular damage associated with high blood pressure and vascular remodeling.

MYADAM and PRPF31 were the only genes from a meta-analysis that linked diastolic, systolic blood pressure and hypertension. These are located on Chromosome 19 between 50-55,000,000 bps, which includes all Killer immunoglobulin like receptors (KIR's), Kallikrein related peptidases (KLK's) and c19MC MiRNA's, in a region characterized by a 2X background deletion rate. During different trimesters it was found that NK cells, in pre-eclampsia, directly incorporate c19MC MiRNA's that are important to placental development and their deregulation could lead to the development of pre-eclampsia. 

It adds up that the massively disproportionate uNK activity in pregnancy and its impact on the mechanics of blood pressure could amplify sensitivities for p53 mediated stress response. It’s known that uNK cells contribute to the remodeling of spiral arteries and regulation of blood pressure, which are critical for fetal development. Similarly, on a cellular scale, abnormal cell growth and expansion of NK cells, may also amplify conditions that direct NK education and licensing to support growth, as in solid tumors and micro-vascular remodeling, or trigger inflammation, through cytokine expression and/or granulocyte killing of expanded missing-self cells. 

All Roads Lead to (Ch)Romosome 19!

A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

A pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure. 

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

p53 - Mediator Of Natural Killer Education

The regulation of rapidly transforming stem cells into trophoblasts and expanding embryonic cell phenotypes, between gestation day 8 and 15 is fast and furious. Research unraveling the finer detail points to the advent of pressure impacting evolving conditions for growth, transformation of cells, microvasculature and resulting tissue types. Notably, Natural Killer (NK) cells expand to around 30% of the cells in the stroma of the uterine wall. These uterine NK (uNK) cell subsets coexist alongside conventional NK cells. This unusual uNK quantitative imbalance motivated our research.   

uNK are closely associated with spiral artery remodeling, for placentation at the blastocyst implantation site. They possess a functional Renin- Angiotensin system (RAS), the cornerstones of blood pressure. The ratio of uNK cells expressing Angiotensin II receptor type 1 (AT1) markedly changed between gestation day 6 and 10. At day 10-12 Atrial Natriuretic Peptide, for vasoconstriction and dilation, strongly co-localized to uNK cells at the implantation sites. Expression of these vasoregulatory molecules by uNK suggests they contribute to the changes in blood pressure that occur between days 5 and 12 coincidental with their population explosion in the decidua during normal pregnancy.

Similar to Angiotensin, Bradykinin (BK) is produced from an inactive pre-protein kininogen that is activated by serine protease kallikrein (KLK), mostly represented on chromosome 19, where they associate with a number of other genes involved in blood pressure. Oakridge scientists predicted that BK induced a Covid19 "cytokine storm" that is responsible for disease progression. 

KLK's are located at 19q13.41, an active transposon region with a 2x background deletion rate clustered near Zinc Fingers and KIR's (Killer immunoglobulin like receptors) that inhibit NK cells.  A link was confirmed in mice uterine NK cells that regulated local tissue blood pressure, by at least AT1, partly in response to mechanical stretch of vasoconstriction and dilation induced by uterine NK's internal RAS. 

In reproduction, at  Chromosome 19 MiRNA Cluster (C19MC), 59 known miRNAs are highly expressed in human placentas and in the serum of pregnant women. Numerous C19MC miRNA's are also found in peripheral blood NK's and at least miR-517a-3p (a C19MC from fetal placenta) was incorporated into maternal NK cells in the third trimester, and was rapidly cleared after delivery. miRNA's also regulate the migration of human trophoblasts and suppress epithelial to mesenchymal transition (EMT) genes that are critical for maintaining the epithelial cytotrophoblast stem cell phenotype. 

In hepatocellular carcinoma (HCC) a co-regulatory network exists between C19MC miRNAs, melanoma-A antigens (MAGEAs), IFN-γ and p53 that promotes an oncogenic role of C19MC and is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 plays an antagonistic role. Its an important immunoregulartory network, because, in the very least, IFN-γ and IL6 have a major baring on the expression of HLA/MHC molecules on cancer cells. 

Immediately adjacent to C19MC, is the leukocyte immunoglobulin-like receptor complex, from where LILRB1 receptor, also known as Mir-7, is expressed on NK cells. It binds MHC class I molecules, on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. LILRB1 has a polymorphic regulatory region that enhances transcription in NK Cells and recruits zinc finger protein YY1 that inhibits p53. It is required to educate expanded human NK cells and defines a unique antitumor NK cell subset with potent antibody-dependent cellular cytotoxicity.

In 2019 a study of arsenite-induced, human keratinocyte transformation demonstrated that knockdown of m6A methyltransferase (METTL3) significantly decreased m6A level, restored p53 activation and inhibited phenotypes in the-transformed cells. m6A downregulated expression of positive p53 regulator, PRDM2, through YTHDF2-promoted decay of mRNAs. m6A also upregulated expression of negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. Taken together, the study revealed the novel role of m6A in mediating human keratinocyte transformation by suppressing p53 activation and sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.

In 2021 a discovery that YTHDF2 is upregulated in NK cells upon activation by cytokines, tumors, and cytomegalovirus infection. YTHDF2 maintains NK cell homeostasis and terminal maturation. It promotes NK cell effector function and is required for IL-15-mediated NK cell survival and proliferation by forming a STAT5-YTHDF2 positive feedback loop. Analysis showed significant enrichment in cell cycle, division, including mitotic cytokinesis, chromosome segregation, spindle, nucleosome, midbody, and chromosome. This data supports roles of YTHDF2 in regulating NK proliferation, survival, and effector functions. 

As part of the 2021 discovery, transcriptome-wide screening identified TDP-43 to be involved in cell proliferation or survival as a YTHDF2-binding target in NK cells. TDP-43 induces p53-mediated cell death of cortical progenitors and immature neurons. Growth of the developing cerebral cortex is controlled by Mir-7 through the p53 Pathway

Here we have broadly described mechanisms by which NK cells maintain tissue homeostasis where tightly regulated p53 optimizes cellular conditions to 'self' educate the expanded NK cells. Those that express NKG2A and/or one or several KIRs, for which cognate ligands are present, become educated and as such transform to potent killers in response to their missing-self. Therefore, p53 isoforms have the innate capacity to promote a cellular homeostasis that makes it the mediator for optimal education of expanded NK cells.

Cancer's HLA-G Backdoor

piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.

When Immunity Fails Programmed Cell Death

DNA Damage Response

Telomeric repeat (TR) sequences are responsible for genome integrity, where instability is a primary factor that leads to activation of p53. Introduction of a TR into cells leads to stabilization of p53, specific to TRs and not observed in plasmids containing non-TR sequences. TR-activated p53 exhibited enhanced transcriptional activity and induced p53-dependent growth suppression, measured as a reduction in colony formation. Sub-telomeric p53 binding prevents accumulation of DNA damage at human telomeres.  

Healthy cells experience thousands of DNA lesions per day. Micronuclei, containing broken fragments of DNA or chromosomes, that have become isolated, are recognized as one mediator of DNA damage response (DDR)-associated immune recognition. Like micronuclear DNA, mitochondrial DNA (mtDNA) is recognized by cGAS to drive STING-mediated inflammatory signaling. Mitochondrial damage can intersect DNA repair and inflammatory cascades with programmed cell death, through p53. In human fibroblasts and conditionally immortalized vascular smooth muscle cells p53 mediates CD54 (ICAM-1) overexpression in senescence.

Replicative senescence, an autophagy dependent program and crisis are anti-proliferative barriers that human cells must evade to gain immortality. Telomere-to-mitochondria signaling by ZBP1 mediates replicative crisis. Dysfunctional telomeres activate innate immune responses (IFN) through mitochondrial TR RNA (TERRA)–ZBP1 complexes. Senescence occurs when shortened telomeres elicit a p53 and RB dependent DNA-damage response. A crisis-associated isoform of ZBP1(innate immune sensor) is induced by the cGAS–STING DNA-sensing pathway, but reaches full activation only when associated with TERRA transcripts from dysfunctional telomeres. p53 utilizes the cGAS/STING innate immune system pathway for both cell intrinsic and cell extrinsic tumor suppressor activities. cGAS-STING activation induces the production of IFN-b and increases CD54 expression in  human cerebral microvascular endothelial cells.

In melanoma patients there is a significant correlation between cGAS expression levels and survival and between NK cell receptor expression levels and survival. Loss of cGAS expression by tumor cells could permit the tumor cell to circumvent senescence or prevent immunostimulatory NKG2D ligands expression. Loss of p53 and gain of oncogenic RAS exacerbated pro-malignant paracrine signaling activities of senescence-associated secretory phenotypes. Results imply that heterogeneity in cGAS activity, across tumors, could be an important predictor of cancer prognosis and response to treatment and suggest that NK cells could play an important role in mediating anti-tumor effects. Coculture of wild-type p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. 

When p53 consensus sequences are modified and DNA damage response is compromised, replicative crisis ensues, mitochondrial membranes misfunction, mtDNA expression is downregulated and IFN signaling upregulates. A cell may then express activating immune ligands that bind NK receptors signaling non-self and cytolytic death or inhibitory receptors that signal self and immortality. 

Indispensable Mitochondria - Cancers back door?

Immediately prior to fertilization spermatozoa are devoid of Mitochondrial DNA (mtDNA), potentially explaining an aspect about selection that may serve the legacy for maternal immune tolerance. Post fertilization, on day 11-13, outermost trophoblasts of the blastocyst dock with the decidual lining as it embeds in the uterine wall. Then, maternal vascular remodeling and placental formation begin toward successful implantation. 

Higher quality trophoblasts are associated with lower mtDNA content. Moreover, euploid blastocysts with higher mtDNA content had a lower chance to implant and mtDNA replication is strictly downregulated between fertilization and the implantation. What is it about absent or reduced mtDNA that may also relate to the mechanics of immune tolerance and vascular remodeling, which are also features of solid tumors.

The initial absence or downregulation of MtDNA, may relate an immune tolerance by uterine Natural Killer (NK) cells. As mtDNA upregulates, after day 12, it may initiate NK auto-reactivity required for maternal microvascular remodeling. This auto-immune paradox is a prerequisite for vascular remodeling, which is also seen in localized hypertension, and the likely basis of successful blastocyst implantation. Acutely, micro-hypertension induced mechanical stretch, on endothelial cells, interconnects innate and adaptive immune responses. 

The dominant cell in the decidua is an NK subset (dNK), they express low levels of IFN-γ and express proteins of Renin Angiotensin System (RAS). At day 12 RAS peptide ANP colocalizes to dNK’s suggesting that dNK RAS infers localized responsiveness.  When TFAM, required for transcription of mtDNA, was deleted from cardiomyocytes, after 32 days, animals developed cardiomyopathy and Nppa (gene encoding ANP) and Nppb expression was elevated. 

In monocytes increased endothelial stretch activates STAT3, which is involved in driving almost all pathways that control NK cytolytic activity and reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis. p53, Stat3, and, potentially, the estrogen receptor are thought to act as co-regulators, affecting mitochondrial gene expression through protein-protein interactions. Co-immunoprecipitation of p53 with TFAM suggests it may regulate mitochondrial DNA-damage repair.

Like initial trophoblasts with low level mtDNA, mature cells, like cardiomyocytes that prolong low level mtDNA may also aggravate autoimmune sponsored hypertension that remodels microvascular networks providing nutrients for growth of reduced mtDNA stem cell replicas. Indeed, mitochondrial dysfunction (from depleted mtDNA) does not affect pluripotent gene expression, but results in severe defects in lineage differentiation.

During severe sepsis, intense, on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. This may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. 

Identifying cells that optimally educate cocultured NK cells for precision IFN-γ and cytolytic responsiveness is part of the ongoing work by the Codondex team.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

ΔΨm and Immune Responses to Disease

Each cell contains hundreds to thousands of mitochondria, each with hundreds of electron transport chain complexes (ETC) that deliver ATP as the cells primary energy source and the central dogma of eukaryote existence. ETC function's, on the inner mitochondrial membrane, are sensitive to change in electric charge represented as mitochondrial polarization and mitochondrial membrane potential (ΔΨm). The large responsive surface area of the outer and inner membrane promotes remodeling and protein interactions that may lead to cellular diseases including cancer.

Tumor Necrosis Factor (TNF) causes mitochondria to relocate, to bind the nucleus and efficiently shuttle elements that enable fast DNA transcription and signaling that, under certain conditions, may suppress the pro inflammatory immune response. TNF signaling to mitochondrial PINK1 stabilizes ubiquitin chains that result in mitochondrial relocation and shuttling activated p65 that increases NF-κB transcription in the nucleus. This anti-apoptotic response resembles the feed forward activation loop in Pink1/Parkin-dependent mitophagy as an independent defense against accumulation of dysfunctional mitochondria, that under physiological conditions integrate their roles in innate immune signaling and stress. 

Enhanced activation of NF-κB by TNF, via mutant p53, concomitantly suppressed the pro-apoptotic effect of TNF leading to increased invasiveness of cancer cells. Accordingly mutant p53 may directly affect nuclear accumulation and retention of p65 upon cytokine exposure as mutant p53 overexpression and nuclear p65 staining in tumors strongly correlated.

Stresses elicited by aneuploid states in cells mediate interaction between Natural Killer (NK) cells. In highly aneuploid cancer cell lines NF-κB signaling is upregulated and activated promoting immune clearance by NK cells, but anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Rapid NF-κB signaling may be preferentially selected because it antagonizes p53, known to inhibit the growth of highly aneuploid cells. Significantly increased mitochondrial DNA in aneuploid cells may result from increased fission of mitochondria, similar to that found in extreme ploidy during Oocyte development. Perhaps supporting the reason in embryonic stem cells (ESC) apoptosis occurs independent of p53 and protein kinase Akt3, the regulator of ESC apoptosis, suppresses p53 for the survival and proliferation of these stem cells.

A comprehensive metabolic analysis identified mitochondrial polarization as a gatekeeper of NK cell priming, activation, and function. Mitochondrial fusion and OXPHOS promote long-term persistence and improve cytokine production by NK cells. Hypoxic Tumor Micro Environments (TME) sustained NK cell activation of mTOR-Drp1, which resulted in excessive mitochondrial fission and fragmentation. Inhibition of fragmentation improved mitochondrial metabolism, survival and the antitumor capacity of NK cells. 

Mitochondrial biogenesis also requires the initiation of Drp1-driven fission. Whereas, fissions from dysfunction are associated with diminished ΔΨm and Reactive Oxygen Species (ROS), which are unchanged in this biogenesis. Depletion of p53 exaggerates fragmentation, but does not affect ΔΨm and ROS levels. Instead, p53 depletion activates mTORC1/4EBP1 signaling that regulates MTFP1 protein expression to govern Drp1-mediated fission. Thus, increased fission upon p53 loss can stimulate biogenesis, but not accumulation of damaged mitochondria. This may explain how mitochondrial integrity, in context of p53 deficiency induced fragmentation, may suppress immune signaling.

Downregulating p53 expression or elevating the molecular signature of mitochondrial fission correlates with aggressive tumor phenotypes and poor prognosis in cancer patients. Upon p53 loss, exaggerated fragmentation stimulates the activation of ERK1/2 signaling resulting in epithelial-to-mesenchymal transition-like changes in cell morphology, accompanied by accelerated MMP9 expression and invasive cell migration. Notably, blocking the activation of mTORC1/MTFP1/Drp1/ERK1/2 axis completely abolishes the p53 deficiency-driven cellular morphological switch, MMP9 expression, and cancer cell dissemination. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

Vascular remodeling, in the uterus, during pregnancy is controlled by small populations of conventional Natural Killer cells that acidify the extracellular matrix (ECM) with a2V-ATPase that activates MMP9, degrades the ECM and releases pro-angiogenesis growth factors stored in the ECM. Hypoxic TME's that sustain excessive mitochondrial fission-fragmentation in NK cells would cause a2V-ATP activated MMP9 to similarly promote angiogenesis akin to Blastocyst implantation.  

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for the 'canary in the mine' of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis, normal immune signaling and response through to mitochondrial biogenesis, differentiation, angiogenesis, reduced immune signaling and response. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

The delicate balance in health and sensitivity of at least TP53 DNA is known to result in DNA to DNA and/or upstream RNA/protein interactions that influence mechanics of molecules and responses to ΔΨm variations. Here we have highlighted links between NK cell function relative to  mitochondrial polarization, ΔΨm and p53 relative to mitochondrial fission and immune signaling. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Angiogenic Growth Factor Flood

A previous series, about p53 culminated with "Blastocyst Development - A Perfected Cancer Model" that focused on the parallels in angiogenesis, triggered by blastocyst implantation and progression of tumors beyond ~1mm. Now, a recent study has found that conventional Natural Killer cells (cNK) control vascular remodeling in the uterus during pregnancy by acidifying the extracellular matrix (ECM) with a2V-ATPase that activates MMP-9 that degrades the ECM. Ablation of a2V-ATPase decreases Bax and p53 expression in testis and leads to implantation failure in the female mouse. The degrading ECM releases bound pro-angiogenic growth factors that contribute to Uterine artery (UtA) remodeling characterized by the loss of vascular smooth muscle cells (VSMCs) and dilation of the vessels. Without cNK, the UtA never lose VSMCs and UtA resistance remains high often leading to implantation failure.

Its logical that a timely flood of angiogenic growth factors, previously stored in the ECM would provide instant availability, but whether this explains the maternal-embryonic immune paradox remains to be determined? In the immune paradox maternal NK cells invade and maternal blood vessels are remodeled just before the arrival of trophoblasts, the external cells of the blastocyst, that carry male antigens during formation of the fetal placenta. A sudden flood of angiogenic factors preceding invading trophoblasts could provide the perfect environment required for maternal arterial/vascular remodeling.

Lymphocytes in the uterine lining (decidua) are dominated by a unique decidual natural killer (dNK) cell population. The dNK cell surface phenotype CD56bright CD16− CD3− and macrophages CD14+ CD206+(dMac) support a model whereby dNK cells, capable of killing extra-villous cytotrophoblasts (CTB), are prevented from doing so by neighboring macrophages thus protecting the fetal cells from NK cell attack. Existing research has centered on the function of the abundant and diverse sets of dNK, but now that cNK cells have been identified to play a more significant role, our understanding of the remodeling are likely to change.

In CTB exogenous p53 is able to down-regulate MMP-9 promoter activity, but endogenous p53 is not able to regulate MMP-9 expression in first trimester CTB cells. Inactivation of p53 through mutation is the most common trait in cancer. By loosing its onco-suppressive activity, p53 becomes oncogenic in almost all malignant tumors (Soussi and Lozano, 2005). Although p53 is not mutated in the human placenta, it has become functionally incompetent. Understanding why and how p53 is functionally incompetent in CTB might well be the key to understanding trophoblast invasion.

Downregulation of EMMPRIN (BSG,CD147) by p53 leads to a decrease in the activity of MMP-9 and an inhibition of tumor cell invasion. Upregulation of EMMPRIN seen in many cancers can be attributed to, at least in part, to the dysfunction of p53 and thus provides new evidence for the roles of p53 in tumor development and progression. Epithelial derived MMP-9 exhibits a novel defensive role of tumor suppressor in colitis associated cancer by activating MMP9-Notch1-ARF-p53 axis. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

The inter-activity of p53, cNK and MMP-9 are complexed, but this novel research may lead to the mechanisms by which arterial remodeling occurs after release of angiogenic factors from ECM. If that shares characteristics of NK invasion into developing tumor micro environment's a new therapeutic approach may arise.

 

Educating Perfect Natural Killers

Mining Tissue Match for Immune Co-culture

Mutant p53 knockdown in KPC (pancreatic ductal adenocarcinoma) cells of immune deficient mice had no effect on primary tumor growth, by contrast the reduced tumor growth in the immune-proficient syngeneic host was due to altered immune cell recruitment.

In vivo, the increased production of pro-inflammatory cytokines coupled with increased Natural Killer (NK) cell ligand expression permits the recruitment of immune cells and clearance of abnormal cells. Elimination of senescent tumors by NK cells may occur as a result of the cooperation of signals associated with p53 expression or senescence, which regulate NK cell recruitment, and other signals that induce NKG2D ligand expression on tumor cells.

Coculture of wild-type (wt) p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. Taken together findings define the involvement of p53 in the regulation of specific NKG2D ligands that enhance NK cell–mediated target recognition.

Inhibitory KIR-educated NK cells showed significantly increased expression of the glucose transporter Glut1 in comparison to NKG2A-educated or uneducated NK cells, with and without exposure to target cells. Educated NK cells displayed significantly higher rates of cellular glycolysis than uneducated NK cells indicating they may reside in different metabolic states prior to activation. The ability to metabolize glucose may represent a mechanism for the superior functionality of educated NK cells expressing KIR receptors. 

Cancer cells acquire immunoediting abilities by which they evade surveillance and escape eradication. Murine p53 missense mutation G242A (human G245A) suppresses activation of host NK cells, enabling breast cancer cells to avoid immune assault. Serial injection of EMT6 breast cancer cells that carry wild-type (wt) Trp53 promoted NK activity, while SVTneg2 cells carrying Trp53 G242A+/+ mutation decreased NK cell numbers and increased CD8+ T lymphocyte numbers in spleen. Upon co-culture with isolated NK cells, EMT6 cells activated NK cells and proliferation, increasing interferon-gamma (IFN-γ) production; however, SVTneg2 cells suppressed NK cell activation. p53 can modulate expression by cancer cells of Mult-1 and H60a activating and inhibitory ligands for NKG2D receptors of NK cells, respectively, to enhance immune surveillance against cancer. p53 is requisite for NK cell-based immune recognition and elimination of cancerous cells, and p53 missense mutant in cancer cells impairs NK cell responses.

NK cells are the oldest member of the innate lymphoid cell family (ILC) and the only representative of cytotoxic ILCs. These tissue-resident innate immune cells have a similar functional diversity to T cells including lineage-specifying transcription factors that drive certain effector programs. ILCs are present in almost every tissue, but strongly enriched at barrier surfaces, where they regulate immunity to infection, chronic inflammation, and tissue maintenance. ILCs orchestrate tissue homeostasis through their ability to sustain bidirectional interactions with epithelial cells, neurons, stromal cells, adipocytes, and many other tissue-resident cells. ILCs provide an integrated view on how immune responses in tissues are synchronized with functional relevance far beyond the classical view of the role of the immune system in discrimination between self/non-self and host defense.

Codondex has evidenced p53 genetic variations, in multiple samples of same biopsy tissue from pancreatic tumors and oral squamous cell carcinoma's that may distinguish host tumor tissue gradients. The effect of highly-specific tissue-selected cell co-culture to educate ILC/NK cells may enhance the prospect for tissue penetration by these expanded, activated cytotoxic cells to improve overall survival.  

Expanding Treatment Horizons

An unrecognized link between p53 function and the immunosurveillance of cancer and infection led to an understanding how p53 influences the expression of MHC molecules at the cell surface via binding interaction with endoplasmic reticulum ERAP1.

Targeted mutations in multiple cancers revealed TP53 gene expression ranged between the 89th and 100th percentile of all expressed transcripts, and raised the possibility that p53 peptides arising from these common mutations might be immunogenic in these patients.

Select KIR-HLA composition favoring antitumor activity could be a promising immunotherapeutic strategy against breast cancer using autologous activated Natural Killer (NK) cell clones. Coexistence of inhibitory and activating killer-cell immunoglobulin-like receptors (KIR) to the same cognate HLA-C2 and HLA-Bw4 ligands conferred breast cancer risk. Inhibitory KIR(iKIR)-HLA pairs without their activating KIR (aKIR)-HLA counterparts were significantly higher in normal controls. Contrarily and adding complexity this suggests NK cells expressing iKIR, to cognate HLA-ligands in the absence of specific aKIR counterparts are instrumental in antitumor response. 

Identification and characterization of the peptides presented by HLA-C, G and E molecules has been lacking behind the more abundant HLA-A and HLA-B gene products. The peptide specificities of these HLA molecules were elucidated using a comprehensive analysis of naturally presented peptides. The 15 most frequently expressed HLA-C alleles as well as HLA-E*01:01 and HLA-G*01:01 were transfected into lymphoblastoid C1R B-cells expressing low endogenous HLA. 

The results (above) include allotype C*02:02 for p53 presentation and indicate the overlap of HLA source protein and top 500 peptides demonstrating the enormous complexity for multivariate analysis of immune response. However,  C*02:02 and C*05:01 have identical contact residues for p8 and p9, the residues of the bound peptide that influences HLA-C interaction with KIR. This suggests peptide effects could contribute to the broader and stronger binding reactions of these two HLA-C allotypes. Interestingly SART3 and MAGEA3 proteins both interact through the p53 pathway and are reported in the peptide study (above) in addition to TP53 to present ligands on C*02:02 and C*05:01. 

Moreover, in vitro  models demonstrated that p53 is required for upregulation of NK ligands. Further, there was a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma (BCC), with a higher likelihood that KIR B carriers harbor abnormal p53 (p<0.004). Together the data suggests functional interactions between KIR and HLA modify risks of BCC and Squamous Cell Carcinoma and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors.

Notwithstanding the enormous complexity between iKIR, aKIR - HLA interactions, immunoterapy must address the highly specific characteristics of autologous precision and discover methods to sensitively educate NK cells so that minimally invasive treatments can be extended to patients who fall outside the patient cohort for strictly regulated treatments. 

Of course, its never that simple...