Hope for a p53 Autologous Natural Killer Cell Therapy

Natural Killer Cells (NK) are much more than cell killers! They possess mechanisms and sensitivities that, among many functions, enables them at the front line of reproduction to interact with incoming trophoblasts that invade the uterine wall where NK cells are critical for blastocyst implantation and pregnancy. NK are members of the innate immune system, but they can be licensed to kill and re-purpose cells whereas most innate immune cells directly target invading pathogens.

Maternal decicdual NK may be redirected by PreImplantation Factor (PIF) expressing, anti-apoptopic, extra-villous trophoblasts that invade the endometrium (epithelioid) of the decidua of the uterine wall. This may result from epithelial LIF expression, and LIFR(eceptors) critical for blastocyst implantation. LIF allele's may act as a NK switch, the direct result of a p53 promoter allele that targets specific LIF transcription, that alters NK interactions with trophoblasts, the host endometria and vascular epithelia. If so, redirection of NK is an essential mechanism of conception that underwrites the development of the placenta.

Studies have revealed p53 targets LIF and demonstrated that, as a secreted protein LIF can function through the Stat3/ID1/MDM2 pathway to negatively regulate p53. Selected alleles in SNPs in LIF, Mdm2, Mdm4, and Hausp genes, each of which regulates p53 levels in cells, are also enriched in IVF patients. This association of SNPs in the p53 pathway with human fertility strongly suggests that p53 regulates human reproduction. It is distinctly possible enriched SNP's invoke regulation that negatively affects p53 and may also be the mechanism by which NK switches between modes that kill or transform its cell targets. In implantation, levels of p53  may lead to pre-eclampsia a condition that is the direct result of increased, p53 dependent apoptosis in extra-villous trophoblasts.

Pathogen-associated molecular pattern–mediated metabolic reprogramming can be considered as a manifestation of innate immune signaling, reprogramming a conserved phenomenon, that changes how we think about the biology and function of the innate immune network.

The mode of NK, in response to cancers may determine the fate of its target either by the binding of innate receptor combinations that initiate an immune synapse and perforin-mediated cytolysis or the release cytokines and chemokines that alters the inflammatory response. It was recently demonstrated these combinations are varied by different tissue and disease depending on p53 for example, in lung adenocarcinoma NK limited target killing and reduced inflammatory response allowing the cancer to spread. Further, peptides derived from p53 are presented by class I MHC molecules and may act as tumor-associated epitopes which could also be targeted by p53-specific T cells.  Results show that selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

These complex tissue dependent modes, through p53 pathways that contribute negative or positive feedback loop's, have prevented the most mutated gene in cancer from itself becoming a target of drug or immune therapy. Using a novel approach Precision Autology's Codondex algorithm computed the variable state of p53 isoforms, using a relative vector distance, from the consensus, to select patient cells for co-culture with, at least autologous NK for use in customized therapy. The approach will enable approved labs to identify highly specific cell targets, in part by their p53 state and to educate autologous NK cells based on a single p53 measure so that NK precision can be calibrated via the mismatch of target receptor combinations and p53.

Natural Killer Shaping A Life

As explained in previous posts, reproduction and innate immunity conspire when maternal Natural Killer (NK) cells of the decidua, lining the uterine wall are coerced to attack maternal epithelial cells, lining spiral arteries that penetrate the decidua to supply nutrients into the rapidly forming fetal placenta. The culprit, extravillous cytotrophoblasts that originate from the external wall of the blastocyst, penetrate the decidua and replace disrupted maternal epithelial cells of advancing spiral arteries. This rejection paradox by the maternal innate immune system, of the foreign male contribution to the blastocyst is mitigated by its trohphoblasts that enable maternal-fetal interface and blastocyst implantation. By day 7 life begins, at least through the handshake of maternal epithelial cells and fetal trophoblasts thus transforming rejection to inception.

Maternal NK enable extravillous cytotrophoblasts to converge with epithelial cells of spiral arteries

Decidual NK constitute 70% of lymphocytes up to the first 20 weeks of pregnancy. They are characterized by their low cytotolytic capacities, but adequately secrete cytokines, chemokines and angiogenic factors. As of 2018 it was unknown as to the effect of these decidual NK cells on earliest stages of pregnancy or how they may transform in context of the developing placenta. As previously discussed allorecognition by decidual NK cells is emerging as the key maternal-fetal immune mechanism that ultimately regulates placentation and that immuno-metabolism played a more significant role in NK activation and cellular transformation.

Single cell analysis at the Fetal - Maternal interface 

Studies of maternal microchimerism suggest that cell's and DNA transferred from mother to embryo can be traced and are prevalent in chord blood. These include NK cells that have been demonstrated to persist following re-transplantation of chord blood. Inferred in these findings, maternal microchimerism's, specifically NK cells transferred at a very early, even in single cell quantities may influence the earliest development of fetal immunity. Indeed at 6 weeks the earliest fetal NK cells are detected in the liver and tend to possess lower lytic potential a characteristic similar to decidual NK.

Maternal decidual NK cells that transfer into the developing placenta probably remain less cytolyic. Given the active environment they may even be metabolically exhausted, but are still capable of lytic activity and could play a critical role eliminating aberrant cells of the rapidly developing embryo. Further this activity could also educate fetal NK cells that start to develop from 6 weeks. Because this exposure occurs during early development of the fetal immune system, the primary response is to develop allospecific tolerance to maternal antigens.

A new concept is emerging in that the uterine immune system uses NK cell allorecognition to regulate placentation and to control the maternofetal interface. The jury is still out on microchimeric influences including exosomes, DNA and whole cells that transfer between mother and fetus. However, it seems entirely plausible that maternal immune cells may do much more than we presently know to shape conditions and determine cells of the fetus.

Our research interest relates to p53 peptides presented by MHC class receptors on targets of NK cells. We maintain the well conserved phospho-acceptor sites of p53 protein in axis with MDM2 is central to immunity and allorecognition. It is known that p53 plays an important role in blastocyst implantation and maternal reproduction through regulation of leukemia inhibitory factor (LIF) in mice. We expect p53 peptides, influenced by transcription regulatory factors determine outcomes of immune-target reactions including blastocyst implantation. Further that TP53 transcription can be triggered in a target by NK allorecognition nano-probe at a distance resulting in target p53 peptide presentation by MHC as NK's go-no-go cytolytic tipping point for immunity.

The Deep Data of Cell Selection.

We identified 16 DNA sequences, each comprising 28 nucleotide's from 15 TP53 transcripts, each comprising ~10,000 intron1 nucleotide's and an mRNA isoform. To make the identification we computed and analyzed relationships between more than 225,000 derived sequences for each transcripts ~10,000 intron1 nucleotide's and mRNA with the same for each of the 15 transcripts.

During analysis we first discovered shorter (than 28 nucleotide) sequences, iterated from the same sequence start position in each transcript and compared them by using a highly ordered vector. The order of the sequences, for each of the 15 transcripts in each vector was compared with the vector computed for the sequences at the next start position. The final selection of shorter length sequences were made from sequences at the most disordered vectors. From these sequences we identified any consecutive 28 nucleotide's, from intron1 of all 15 TP53 transcripts that fully incorporated more than one of these shorter length sequences, no less than 8 nucleotide's.

In each of the 16 DNA sequences, 4 or 5 (complex) shorter length sequences were discovered in their  identical nucleotide combinations suggesting a broad sequence affinity with these shorter length intron1 sequences.

We ran a series of 8 sequence alignment tests to determine whether there was anything special about the 16 DNA sequences of length 28 and the shorter sequences used to identify them. Each test used an algorithm to optimize the ordering of the sequences according to a sort score. This score assigned points to each A|T|C or G character that was aligned with the next of the 16 length 28 sequences or the next sequence of any length in the ordering. Each of the 8 tests varied the points weighting assigned to the length 28 alignment, while points assigned to the next alignment were kept constant. This was expressed as a ratio but left un-normalized. As a control we scrambled the ordering of the letters in each sequence and applied the same algorithm to optimize for a sort score, obtaining the following results.

Scoring Ratio (L28:Next)	0.5:1	1:1	1.5:1	2:1	3:1	5:1	7.5:1	10:1
Sequence Score	922.5	1288	1734	2144	2923	4539	6563.5	8517
Randomized Score	742.5	1036	1373.5	1072	2367	3631	5362	6917

8 organizations of 16 x 28 oligonucleotide sequences and shorter lengths

The order bias toward Sequence Score (resulting from our selection process) is evident in the chart and numbers above. It indicates that the 16 identified DNA sequences and those used to select them have better alignments than the random alternatives. In previous randomization studies we determined the vector performs similarly against two methods of randomization's which are described in detail at the link.

These methods form part of our neural network initiative and will be used during the process of cell selections for autologus immune therapy using patient derived Natural Killer cells. 

Blastocyst Development - A Perfected Cancer Model?

A p53 orchestrated mechanism is required for a blastocyst to implant and penetrate the uterine wall. A trophoblast induced, uterine Natural Killer cell (NK) response against endothelial cells follows resulting in significant vascular remodeling and immune suppression. Similarities parallel p53 in cancer stem cells that influence fibroblast pro-invasiveness, recruit NK to invade endothelial cells during angiogenesis, vascular remodeling and immune suppression. The previous blog entry and various papers follow in support.  

Leukemia inhibitory factor (LIF) and LIF receptor expression in human endometrium suggests an autocrine/paracrine function in regulating embryo implantation. The necessary expression of LIF, under p53 control peaks coincidental to blastocyst implantation inviting the question whether blastocyst invokes a paracrine response in endothelial cells of the endometrium?

In mice p53 plays an important role in maternal reproduction through transcriptional regulation of LIF, a cytokine required for blastocyst implantation. To determine whether observations could be extended to humans, a list of single-nucleotide polymorphisms (SNPs) in the p53 pathway that could modify the function of p53 was assembled and used to study their impact on human fertility. Indeed, there is evidence for p53 in reproduction and fecundity. Recent studies with haplotypes of SNP’s in the Mdm4 and Hausp genes also demonstrated the positive evolutionary selection toward alleles in Caucasian populations. These observations suggested p53 has evolutionary conserved functions. p53-like transcription factors are conserved from invertebrates to vertebrates, and the existence of p53-like proteins in short-lived organisms that do not exhibit adult cancer, such as flies and worms suggests that tumor suppression was not the original function for p53 and its pathway. 

If SNPs in the p53 pathway regulate human fertility under selective pressure it may suggest similar for immunity and cancer where p53 is the most mutated of all gene’s. The identification of functional SNPs that mediate the p53 stress response is challenging, as there are more than 50,000 SNPs in the NCBI SNP repository (dbSNP) in genes that have been implicated in mediating and regulating the p53 response (Vazquez et al. 2008)

LIF was also identified as a tumor promoter that mediates pro-invasive activation of stromal fibroblasts. It was demonstrated that a pulse of transforming growth factor beta (TGF-β) established stable pro-invasive fibroblast activation by inducing LIF production in both fibroblasts and tumor cells. LIF, a member of the IL-6 proinflammatory cytokine family is the main driver of proinvasive TGF-β-dependent evolution of the tumor microenvironment. LIF mediates autocrine TGF-β1-dependent pro-invasive activation in fibroblasts, whereas, in a paracrine manner, tumor-secreted LIF promotes and sustains pro-invasive conversion of fibroblast.

The proinflammatory cytokine LIF reprograms fibroblasts into a pro-invasive phenotype, which promotes extracellular matrix remodelling and collective invasion of cancer cells. Recently Adorno et al. demonstrated that the mutational status of p53 determines the nature of the cellular response to TGF-β. Introduction of wild-type p53 into p53 null H1299 cells resulted in a TGF-β-induced growth arrest via p21. In contrast reconstitution with mutant p53 caused cells to change from an epithelial to mesenchymal morphology, enabling a promigratory TGF-β response, TGF-β is expressed both in endometrial and trophoblastic cells of the blastocyst. TGF-β was shown to inhibit trophoblast proliferation and invasion apparently by stimulating TIMP secretion and decreasing MMP activation through downregulation of plasminogen activators. In another study TGF-β was found to inhibit trophoblast invasion by reducing MMP-9 and uPA secretion, but did not affect TIMP levels or cell proliferation. Elevated TGF-β activity has been reported in the plasma of pre-eclamptic mothers and may be implicated in the impaired implantation associated with pre-eclampsia.

Anergized NK through secreted cytokine factors and direct cell to cell contact have the ability to induce differentiation of stem cells including squamous cancer stem cells resulting in resistance or vulnerability to NK mediated cytotoxicity.

Peptides derived from p53 are presented by class I MHC molecules and may act as tumor-associated epitopes which could be targeted by p53-specific T cells. Differential T cell recognition patterns of p53 proteins, measured by IFN𝛾 secretion seems to be confined to p53 as an antigen as expression of different p53 mutants neither altered HLA-A0201 surface expression nor impacted on the recognition of another (control) antigen (MART-1). Our results show that selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels. Thus, p53 may behave differently than other classical tumor antigens and its mutational status should therefore be taken into account when elaborating immunotherapy treatments of cancer patients targeting p53.

These paracrine and autocrine interactions describe some of p53’s unique, highly specific signaling capabilities in immune and reproductive control and reorganization. In both, host immune cells are recruited by cytokines that are expressed by invading trophoblasts or cancer stem cells. These invading cells modify, or kill host endothelial cells resulting in a p53 orchestrated phenotype that permits invading cells to remodel capillaries to manage immune responses that would otherwise destabilize the tumor microenvironment or endometrium.

The signaling capabilities of p53 are the target of Precision Autology's Codondex algorithms for use in cell selection and therapy. 

Death or Sex? Cancer through Reproduction's Eye

Article by Kevin Bermeister

Sex in humans can be traced to the evolution of a Sea Squirt and FuHc, a surreptitiously named gene. But, sexual pursuit didn’t initiate diversity of life, immunity from death did! In a previous article I explained how allorecognition in Sea Squirts, from different colonies resembled polarization at the contact point of an immune synapse between a Natural Killer cell (NK) and its target.

In early stage reproduction an “immunological paradox” occurs at the implantation site in the uterine wall where unexpected, male fertilized blastocyst is not rejected. Allorecognition occurs because maternal NK invades and remodels maternal blood vessels before the arrival of trophoblasts, the external cells of the blastocyst, that carry male antigens, during formation of the placenta that provides the fetus with nutrients.

Sperm and ovum require gametes which are produced during meiotic cell division through phases of cellular polarization. Telophase (see image) resembles NK bound to its target just before the irreversible step that leads to perforin release and the target’s death. In this first Telophase, the yet to be separated pre-gametes contain twice the number of chromosomes, similarly when NK is enjoined to its target. Curiously, inhibitory and activating NK receptors that bind target cells diversify only through meiosis where in gametes the centrosome required for polarization has degenerated.

During meiosis as every gamete was made, research showed the first enzymatic step in meiotic recombination provoked a transient burst of p53 activity. Now it seems equally possible these p53 bursts could be attributed to relaxed transposon (mobile DNA) controls that accompany the meiotic process. Indeed, meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions including in animals lacking p53.

Mature NK can kill its target cell when combinations of inhibiting and activating receptors mediate a ‘non-self’ condition that triggers its polarization. At that point cytotoxic perforin and granzyme release toward the contact point, but NK can cancel the process. Reduced perforin release and binding in the immune synapse between these bound cells underlies the age-related decline in NK cytotoxicity. NK polarization and more generally cells undergoing division may also contribute to our understanding of ageing.

Courtesy

Here, we propose that certain features of the ageing process such as: (i) the increased reactivation rates of latent Mycobacterium tuberculosis, (ii) the slower resolution of inflammatory responses and (iii) the increased incidence of bacterial and fungal infection are attributable in part to an age-associated decline in NK function.

This paper demonstrated a pronounced age‐related impairment in perforin mobilization by NK to the K562 (target cell) contact point. It suggested that defective polarization to the immune synapse underlies the reduction in perforin secretion observed with age. The activation of mitogen‐activated protein kinases (MAPK) is critical for lytic granule (perforin-granzyme) polarization, granule exocytosis and NK Cytotoxicity. It is possible that these proximal signaling events are compromised by aging. In addition, it found that the studied p53 mutants regulated MAP2K3 gene whereas ectopic expression rescued the proliferative defect induced by mutant p53 knockdown.

Experimentally, NK that are absent of perforin or granzymes remain engaged five times longer. These locked-up NK cells would normally move to their next cell target to clear senescent or diseased cells, but cannot. NK suffering age-related reduced perforin release remain engaged awaiting a death signal from the target. This delay could be the single physiological cause of old or diseased cell accumulation in the body that is a primary cause of ageing. Perhaps polarization is causal?

Courtesy

Interestingly a member of the cytoskeleton superfamily Talin1 has been uniquely tied to two essential NK functions; 1. activation of LFA1, required for binding ICAM on NK target cell and, 2. NK polarization that results. We know overexpression of talin head activates LFA-1 and talin1 promotes cell proliferation by affecting the expression of BCL-2 family and p53 network. But, mdm2 the conserved nemesis of p53 is neutralized by Merlin, another cytoskeleton superfamily protein required for polarization. p53 also regulates the highly conserved Cdc42 which effects adhesion, actin cytoskeletal dynamics and cell movement including for angiogenesis in developing tumor microenvironments.

Through the p53 pathway Preimplantation Factor (PIF) is secreted by the blastocyst implant to reduce apoptosis in villous trophoblast lined vessels protruding as the developing placenta penetrates the decidua lining the uterine wall. Simultaneously maternal NK attack maternal endothelial cells lining arterial connections growing through the decidua. Opportunistically the apoptosis protected trophoblasts substitute dead maternal endothelial cells lining the connections. Thus mother succumbs to baby and the “immunological paradox” of maternal connection to embryonic placenta is overcome.

Furthermore, invalidation experiments demonstrate that PIF’s effects on placental apoptosis were mediated by TP53. Interestingly, the non-cancerous tissue associated with the over-expression of NK inhibiting ligand PCNA is the deciduas, and the only known NK cell subset that constitutively expresses NKp44 receptor for PCNA ligand is decidual NK cells. The PCNA gene is induced by p53 in the process of deciding cell fate, if PCNA is present in abundance in the absence of p53, DNA replication occurs.

However, fetal platelet antigens that cause miscarriages have been shown to prolong uterine/decidual NK survival, elevate NKp46 (LY94) receptor expression, perforin release and trophoblast apoptosis. The same receptor was also found to cluster at the NK-target cell immune synapse to regulate cytoskeletal organization and NK polarization on which perforin release is dependent.

Several common villous cells are implicated including NK, trophoblasts, vascular tip cells and cancer cells that may also induce NK to chaperone their effecting or replacing endo-epithelial cells lining host blood vessels. In the presence of senescent cells including NK with reduced perforin release, cancer cells may have discovered a trophoblast related back door to remodel blood vessels to serve transformed cells that ultimately grow to become cancerous tumors.

It’s distinctly possible that this p53 tug-o-war may be central to cellular age, death, reproduction and growth influenced by polarization and the perforin related effectiveness with which NK kills its meiosis evolved non-self targets.

At Precision Autology, the parent company of Codondex, we discover a patients p53 cell signatures to select their specific cancer cells, educate their natural killer cells to identify and kill the cancer that induced NK into its cooperative state.

Immunity and reproduction two sides of the p53 coin

Article authored by Kevin Bermeister

We argue the case that wide-ranging effects of the TP53 gene can be attributed to immunity, reproduction and cell death. Research has been selected to illustrate the probability that highly conserved elements of this protein have been central to the evolution of converged pathways and cellular systems in humans. Similarly, that innate and adaptive immunity share pathways that are not yet determined.

The relationship between p53 protein in a Natural Killer (NK) cell and its potentially diseased target arise from an elaborate, ancient, self preservation mechanism that can trace common lineage to replication in the earliest species of jawless invertebrate colonies. Individual colonies reproduce asexually, but individuals from two colonies first allorecognize their compatibility via their contacted ampullae and two individual immune reactions that determines the level of fusion or rejection. Every gene has two alleles, when two colonies share one or both FuHC alleles, they will fuse, whereas rejection occurs if no alleles are in common.

Jawless invertebrates like the “Sea Squirt” branched to jawed vertebrates, ultimately humans. In the the periodontal ligament of human jaws, between tooth and the jaw-bone Gingival fibroblasts co-mingle with cells of the immune system including innate NK cells.

In experiments it was discovered these immune system cells are sustained for extended periods especially in the presence of Gingival Fibroblasts (GF's). These mucosal fibroblasts of the periodontal ligament may be the primary source of mature-licensed NK cells in circulation perhaps a remnant from zooids and the tunic of tunicates like the “Sea Squirt”.

In mammals, NK cells are large, granular lymphocytes that recognize MHC class I molecules on target cells via inhibitory NK cell receptors. After binding a target ligand the NK receptors can transmit an inhibitory signal that cancels a program for cytotoxic action previously triggered by contact with the target cell.

In vertebrates CD94 is one of the markers for NK cells that binds to MHC class I molecules that have also been implicated in sexual selection in humans. NK cell lineage has been traced through the CD94 family of receptors to Urochordates (like the Sea Squirt) where transplant immunity was described after tests conducted for immune resistance between colonies. It was shown that the gene, BsCD94-1, is differentially regulated during allorecognition and that a subpopulation of blood cells carries the corresponding receptor on its cell surface. Analysis of DNA from individual colonies and intronless BsCD94-1 probe revealed variation between individuals at the genomic level.

In Zebrafish, during reproduction p53 is central to the reversal of sex through apoptosis that kills one line of germ cells to yield either ovary or testes. The p53 pathway members have been investigated extensively in jawed vertebrates, and found that genes for all three Tp53 family members as well as Mdm2 and Mdm4 were present in the common ancestors. Homologs of all members of the p53 family as well as the negative regulators Mdm2 and Mdm4 are present in the Japanese lamprey (image right). Functional studies showed that sequence conservation was reflected in biochemical activity and the ability of lamprey-Mdm2 protein to function as a very effective E3 ubiquitin ligase (that degrades p53) in mouse cells.

Of the dozens of phospho-acceptor sites reported on p53 only three (Ser15, Thr18, Ser20) are highly conserved between humans and urochordates, the latter being where a bona-fide p53-MDM2 axis has appeared in evolution. Especially striking is the conservation of primary amino acid homology in the p53 transactivation domain between the invertebrate Sea Squirt and humans, indicating that as yet undefined evolutionary selection pressures have maintained this amino acid sequence at least since this Urochordate lineage.

Data strongly suggests that the p53 pathway plays an important role in human fertility. Identifying higher risk polymorphisms for pregnancy failure could provide patients with more accurate predictions of their IVF success rates. In humans, functional SNPs have been identified in both p53 and its negative regulator, Mdm2, which can alter the levels or function of p53. Interestingly, it appears that these SNPs (the p53 R72 allele and the G allele in Mdm2) are under evolutionary positive selection pressure in Caucasian and Asian populations.

The p53-mdm2 axis is implicated in Natural Killer cell neoplasms, which occur in mucosal sites. This is a rare but aggressive form of cancer of NK cells. These cells express high levels of mdm2 (an E3 ubiquitin ligase) that is highly effective degrading p53 and is presumed to be primarily responsible for a reduction in p53 levels. Alternatively PIDD-induced Caspase-2 directly cleaves Mdm2 at Asp 367, leading to loss of the C-terminal RING domain responsible for p53 ubiquitination. As a consequence, N-terminally truncated Mdm2 binds p53 and promotes its stability. Upon DNA damage, p53 induction of the Caspase-2-PIDDosome creates a positive feedback loop that inhibits Mdm2 and reinforces p53 stability and activity, contributing to cell survival and drug resistance.

In addition to regulating NK cell ligand expression, genetic reactivation of p53 in tumors can also induce a wide array of pro-inflammatory mediators ranging from adhesion receptor (ICAM-1) expression [ligand for LFA-1] to the production of various chemokines (CXCL11 and monocyte chemoattractant protein-1) and cytokines (interleukin-15). Furthermore, recent studies in anti-viral immunity indicate that several interferon-inducible genes and Toll-like receptor-3 expression are direct transcriptional targets of p53 and that p53 contributes to production of type I interferon by virally infected cells.

Gingival fibroblasts, present in the alveolar bone-lining mucosa (i.e., the gingiva), are thought to play a role in the recruitment of immune cells toward the inflamed periodontium. There is extensive literature suggesting that monocytes can differentiate into pre-osteoclasts and eventually fuse into multinucleated bone-resorbing osteoclasts. The role of GF's in osteoclastogenesis was shown by in vitro cocultures of GFs with peripheral blood mononuclear cells (PBMCs), where osteoclast-like cells formed after 21 days. Cell–cell contact between gingival or periodontal ligament (PDL) fibroblasts from the periodontium and osteoclast precursors is required for osteoclastogenesis. We hypothesized that GF's play a role in the retention, survival, and proliferation of lymphocytes. Our findings show that GF's support the retention and survival of T, B, and NK cells by LFA-1 expression [that binds to ICAM-1]. Importantly, expression did not differ over time, which indicates that it is a process, which is initiated before 14 days and stays constant after 21 days, explaining the survival and retention of lymphocytes in GF cocultures.


Incidentally it has been shown that phagocytosis in coral reef immunity is linked to Cdc42, a gene responsible for cell cycle regulation and division. Data also demonstrates a previously uncharacterized role for p53 in regulating Cdc42-dependent cell effects that control actin cytoskeletal dynamics and cell movement.

Image (A,B,C) illustrates the immune reaction at touching tips of ampullae of jawless invertebrates. It resembles immune response between NK and its target including the formation of immune synapse and granularization. The synapse, allorecognition and transfer of cells also echoes the origin of sexual reproduction between fusing individuals.

An explanation is applicable to the tumor suppressor gene p53, which has conflicting roles on the induction of autophagy (and subsequent cell death) depending on its location in the nucleus or cytoplasm. Similar to toxin-antitoxin systems in bacteria, some have questioned whether p53 would be better characterized as a cell-death or a cell-survival gene. After initial contact it is proposed that a NK cell would determine its targets’ ultimate fate through receptor mediated exosomes containing miRNA samples that induce p53 isoforms to confirm non-self. The p53 pathway regulates the production of exosomes into the medium and these vesicles can communicate with adjacent cells and even cells of the immune system. Such an important mechanism could have productive or devastating effects.

Individual cases support the hypothesis that p53 in NK and target cells are coordinated in this process. One in particular involved a mirrored mutation. A point mutation in exon 7 of the p53 gene was detected in the KHYG-1 cells and direct sequencing revealed the conversion of C to T at nucleotide 877 in codon 248. The primary leukemia cells also carried the same point mutation. Although the precise role of the p53 point mutation in leukemogenesis remains to be clarified, the establishment of an NK leukemia cell line with a p53 point mutation could be valuable.

The features of a lymphoblastoid natural killer (NK)-cell lymphoma presenting in the skin in a young caucasian woman are described. The disease behaved aggressively, but long-lasting remission was obtained by combination chemotherapy followed by autologous bone marrow transplantation. The blastoid cells were positive for terminal deoxynucleotidyl transferase, CD34, CD56 and CD4. Furthermore, the NK-cell receptor complex CD94/NKG2 was strongly expressed. Molecular analysis showed no abnormalities of the CDKN2A (p16), CDKN2B (p15) or TNFRSF6 (Fas) genes. By contrast, a 34-bp deletion in exon 7 of the TP53 (p53) gene was detected. It is suggested that lymphoblastoid NK-cell lymphoma, which is a rare but distinctive disease, originates from NK cell precursors and may be associated with and possibly caused by alterations in the TP53 gene.

In one patient the same intronic point mutation was found in the tumor cell line derived from a bone marrow metastasis and in multiple liver metastases but not in normal DNA, indicating that it occurred as a somatic event before the development of these metastases. These findings further support the role of inactivation of the p53 gene in the pathogenesis of lung cancer and indicate the role of intronic point mutation in this process.

Our objective at Precision Autology is to compute Codondex iScore's on introns and p53 mRNA to identify highly a patient's desirable cells. After coculturing these cells with a patient's NK cells, sufficient maturity for immune response is expected to be achieved. On reintroduction to the patient,  NK rejection of unrecognized tumor cells is expected to stimulate a Dendrite led immune cascade. The precise sequence of events follows from initial cell selection and immune education that cascades to a full and appropriate immune response.

Mathematical vectors in biology

Mathematical vectors in biology!

We built a model to determine whether a random or non-random relationship existed between introns and proteins of transcripts. We determined the relationship was overwhelmingly non-random and progressed to study particular genes in more detail.

Based on our studies we suggested TP53 readily encodes specific isoform concentrations that alter next generation transcriptions and introns play significant roles. Here we validate our selection logic and describe its proposed use in immunotherapy. From intron1, we computed +400k k-mers from which we selected 8 short k-mers out of 12 TP53 and 29 BRCA1 transcripts. We synthesized the sequences and In subsequent transfection experiments 3/3 TP53 and 3/5 BRCA1 significantly (p<0.05) reduced the rate of proliferating HeLa cells.

Selection Background

For each transcript we first computed intron1 k-mers greater than 7 oligos (see image below, each k-mer has an Offset#). For all k-mer’s we computed a signature and associated it with a signature of the transcripts’ protein. In Offset# order, for each k-mer of each transcript we ordered transcripts according to the result of a k-mer:protein signature ordering.  For each offset# (k-mer) we recorded the order of each transcript in a vector.

In offset# (computation) order, we observed the next vector to discover any changes in ordering of transcripts. After filtering k-mers for a length change, more than 90% of transcript ordering remained stable. Occasionally one or two transcripts changed position, very rarely more than 75% of transcripts in the vector changed position. So when we discovered a few vectors with >75% change we extracted them and subjected them to a selection algorithm that  identified 8 short, 28 oligo sequences from the 41 transcripts processed.

Codondex iScoreTM ordering, comparison and selection algorithms consider that transcripts compared at sequential k-mers represents a compelling method to identify sequences that “stand out from the crowd” because they may be inherent upstream of transcription. Potential of any k-mer exists to aggregate or contribute to the formation of coacervates in a sequence and length dependent manner. In the image above red text represents our computation of the first 14 of 135 potential k-mer’s of the identical 23 oligo sequence. For each k-mer all k-mers of the 23 oligo sequence would be queried (in both directions) and repetitions counted. For example of the 14 k-mers, the k-mer at Offset#0 can also be found in Offsets#2,5,9 and 14.

In the compound computation of the 23 letter sequence, Offset#0 GTGGGAAT is repeated in 16 other k-mers and Offset#135 GTGGGAATCTTATCCATGACCCA has 136 k-mers repeated in it (including itself). When looking at the entire intron sequence (or any long sequence) there is never a linear progression of k-mers, inevitably the counts becomes disordered.

In the following example of ordering transcript computations for a single Offset#, each result has been ordered in a vector of 15 men1 transcripts. Each protein signature is constant for every Offset# because the signature is computed from the entire string. Some protein signatures are identical, but not intron signatures. Transcripts with identical protein signatures are preferentially sorted to give final order to transcripts in the vector.

15 transcripts, for a single k-mer (Offset#) in a vector

In our detailed review of each transcript we discovered that the compound effect of k-mer repeats described an inherent structure of relationships between nucleotides lengths. We considered how varied transcription events would alter the representations of these non-coding oligo lengths in their ncRNA form. For example, Offset#135 included 136 repeats of k-mers, which statistically infers it has a greater chance of survival and/or function in any of its constitutive parts than a k-mer with a lesser number of repeats.

As stated in the opening paragraph we synthesized 8 short RNA selections we made using our vectors to discover how they translated in biology. In future we intend to compute p53 (or other gene) transcripts from multiple samples of a patient biopsy. We do this by separating cells into multiple wells, running RNAseq on each well and computing the transcript position of each well in our p53 vectors. Once we identify the logarithmic proximity of each wells transcript to other transcripts we will select a well. We will use selected cells to educate natural killer cells extracted from the patient and return the immune cells only to the patient to reduce proliferation of diseased cells. We hope to bring this therapy to the market in the next few years.