Showing posts with label mhc. Show all posts
Showing posts with label mhc. Show all posts

Tuesday, March 3, 2026

Natural Killers, Mitochondria, p53, and Parkinson’s


The emerging landscape of neuro-immune communication reveals that the traditional boundaries between immune sentinel function and neuronal integrity are far less distinct than once imagined. One useful framework for understanding Parkinson’s disease (PD) begins with environmental triggers, particularly persistent toxins such as dioxins and related xenobiotics. These compounds can initiate a molecular cascade: toxin exposure → mitochondrial dysfunction → oxidative stress → p53 activation → neuronal apoptosis. Embedded within this cascade is a regulatory layer involving bHLH-PAS transcription factor complexes, including AHR–ARNT and HIF1A–ARNT, which bind promoter elements containing GCGTG/GCTGTG motifs and coordinate cellular responses to environmental and metabolic stress. The toxicological effects of dioxins are largely mediated through activation of the aryl hydrocarbon receptor (AHR) transcription pathway (see research overview: https://espace.library.uq.edu.au/view/UQ%3A382961).

Within this molecular framework lies another equally compelling axis: the role of Natural Killer (NK) cells as innate effectors at the neuro-immune interface. These cells, capable of homing to inflamed neural tissue and scavenging pathological aggregates such as α-synuclein, emerge not as passive bystanders but as regulators of disease progression. Experimental work has demonstrated that NK cells can internalize and degrade extracellular α-synuclein aggregates, and that NK-cell depletion significantly worsens synuclein pathology in mouse models of Parkinson’s disease (Nature Communications research summary: https://pmc.ncbi.nlm.nih.gov/articles/PMC6983411/).

NK cells are uniquely positioned to influence neural landscapes because they bridge innate immunity with neuronal signaling. They communicate not only through cytotoxic mechanisms but also through synapse-like contacts and cytokine signaling that mirror the bi-directional dialogue inherent to neural circuits. Reviews of immune mechanisms in PD increasingly highlight NK cells as modulators of neuroinflammation and α-synuclein pathology (Frontiers in Aging Neuroscience review: https://www.frontiersin.org/articles/10.3389/fnagi.2022.890816/full).

This neuro-immune unit invites us to see PD not solely as a problem of intrinsic neuronal failure, but as a disturbance in the regulatory network connecting environmental sensing, immune surveillance, and neural homeostasis.

At the center of this network sits the aryl hydrocarbon receptor (AHR), a toxin-sensing transcription factor activated by environmental pollutants such as dioxins and polycyclic aromatic hydrocarbons. Once activated, AHR forms a heterodimer with ARNT and binds regulatory DNA elements containing GCGTG-type motifs, initiating transcriptional programs that reshape metabolism and stress responses. A parallel sensing system operates through HIF1A, another bHLH-PAS transcription factor that binds related RCGTG/GCGTG promoter motifs during mitochondrial dysfunction or oxygen imbalance. Importantly, studies show substantial crosstalk between AHR and HIF signaling pathways, allowing environmental toxins and metabolic stress to converge on shared transcriptional targets (Life Science Alliance research: https://pmc.ncbi.nlm.nih.gov/articles/PMC9896012/).

For neurons—particularly the metabolically fragile dopaminergic neurons of the substantia nigra—persistent activation of toxin-responsive pathways can have profound consequences. Xenobiotic metabolism generates oxidative stress and mitochondrial injury, activating p53, the master regulator of cellular stress responses. As explored in earlier Codondex work on mitochondrial signaling and p53-regulated RNA networks, mitochondrial dysfunction and p53 activation are tightly intertwined components of cellular stress adaptation.

But these pathways do not operate only within neurons. p53 signaling and mitochondrial health also influence immune cells, including NK cells. NK cells rely heavily on mitochondrial metabolism for effective surveillance, cytokine production, and cytotoxic function. When toxin exposure disrupts mitochondrial integrity systemically, it may impair the very immune cells responsible for clearing damaged neurons and pathological protein aggregates.

Recent studies confirm that NK cells are present in brains affected by PD and may influence disease course, scavenging α-synuclein aggregates and modulating neuroinflammation. Experimental depletion of NK cells exacerbates synuclein pathology and inflammatory responses in PD models (Cellular & Molecular Immunology study: https://www.nature.com/articles/s12276-020-00505-7).

Viewed through the lens of toxin vulnerability, the cascade becomes clearer:

Environmental neurotoxicants such as dioxins activate AHR, engaging GCGTG-containing promoter elements and reshaping transcriptional programs governing metabolism and inflammation. Toxin-induced mitochondrial dysfunction stabilizes HIF1A, reinforcing stress-adaptation pathways.

In neurons, these converging signals activate p53-dependent apoptotic programs, leading to dopaminergic neuron loss.

In immune cells, including NK cells, mitochondrial impairment and p53 signaling influence metabolic fitness and cytokine output.

Thus the integrity of mitochondrial networks becomes a common currency between neuronal survival and immune effector competence. Rather than viewing PD strictly as a neuronal degenerative disorder, integrating environmental toxin sensing with immune biology suggests a broader model in which:

Environmental pollutants such as dioxins and related xenobiotics prime cellular stress responses through AHR-mediated transcription. These signals converge with HIF1A and p53 pathways, amplifying mitochondrial dysfunction.

NK cells and other innate lymphocytes respond to neuronal danger cues and help clear pathological aggregates, but their effectiveness is constrained when toxin exposure disrupts systemic mitochondrial health. In this perspective, Parkinson’s disease emerges as a neuro-immune network disorder shaped by environmental vulnerability, where toxin sensing, mitochondrial integrity, transcriptional stress responses, and immune surveillance converge.

Wednesday, February 28, 2024

p53 Convergence and Immunity

Renewed interest in Bradykinin and its inactivation, by Angiotensin Converting Enzyme (ACE), during Covid infection reconfirmed RAS and KKS (Kallikrein-Kinin, Bradykinin) as the major systems of vasodilation and constriction contributing to blood pressure and disease. ACE2, a molecule of focus in Covid, reduces the Bradykinin product des-Arg9 bradykinin to inactive metabolites.



In pre-eclampsia reduced Kallikrein (KLK) generation and Bradykinin's activation, via its BK1 and BK2 receptor, modulates stress response through NF-κB and p53 pathways. These are the major cellular stress response pathways that promote or oppose apoptosis and influence cell fate. Two functionally divergent p53-responsive elements were discovered in the rat BK2 receptor promoter, which interact with ACE, play a significant role regulating vascular tone and blood pressure and in the cross-talk between RAS and KKS

In uterine immune cells RAS proteins AT1, AT2, and ANP are expressed and ANP co-localizes to uterine Natural Killer (uNK) cells between pregnancy day 10 and 12, immediately before spiral arterial modification. In mice this suggested that uNK contributes to the physiological changes in blood pressure between days 5 and 12.

During the first trimester the uNK cells dramatically increase, from around 15% to 70% of immune cells in the Decidua of the Uterus. Expressed RAS-KKS proteins during this time may be solely responsible for amplified stimulation of the plasma contact system at least via p53-mediated transcription and activation of the BK2 promoter.

In myocytes stretch-mediated release of angiotensin II (AngII) induced apoptosis by activating p53 that enhanced local RAS and decreased the Bcl-2-to-Bax protein ratio in the cell. In endothelial cells mechanical stretch interconnected innate and adaptive immune response in hypertension. This suggests that mechanical forces, such as those experienced in hypertension, can influence the immune system and contribute to inflammation, vascular damage associated with high blood pressure and vascular remodeling.

MYADAM and PRPF31 were the only genes from a meta-analysis that linked diastolic, systolic blood pressure and hypertension. These are located on Chromosome 19 between 50-55,000,000 bps, which includes all Killer immunoglobulin like receptors (KIR's), Kallikrein related peptidases (KLK's) and c19MC MiRNA's, in a region characterized by a 2X background deletion rate. During different trimesters it was found that NK cells, in pre-eclampsia, directly incorporate c19MC MiRNA's that are important to placental development and their deregulation could lead to the development of pre-eclampsia. 

It adds up that the massively disproportionate uNK activity in pregnancy and its impact on the mechanics of blood pressure could amplify sensitivities for p53 mediated stress response. It’s known that uNK cells contribute to the remodeling of spiral arteries and regulation of blood pressure, which are critical for fetal development. Similarly, on a cellular scale, abnormal cell growth and expansion of NK cells, may also amplify conditions that direct NK education and licensing to support growth, as in solid tumors and micro-vascular remodeling, or trigger inflammation, through cytokine expression and/or granulocyte killing of expanded missing-self cells. 


Sunday, January 28, 2024

All Roads Lead to (Ch)Romosome 19!


A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.  

Monday, January 1, 2024

p53 - Mediator Of Natural Killer Education


The regulation of rapidly transforming stem cells into trophoblasts and expanding embryonic cell phenotypes, between gestation day 8 and 15 is fast and furious. Research unraveling the finer detail points to the advent of pressure impacting evolving conditions for growth, transformation of cells, microvasculature and resulting tissue types. Notably, Natural Killer (NK) cells expand to around 30% of the cells in the stroma of the uterine wall. These uterine NK (uNK) cell subsets coexist alongside conventional NK cells. This unusual uNK quantitative imbalance motivated our research.   

uNK are closely associated with spiral artery remodeling, for placentation at the blastocyst implantation site. They possess a functional Renin- Angiotensin system (RAS), the cornerstones of blood pressure. The ratio of uNK cells expressing Angiotensin II receptor type 1 (AT1) markedly changed between gestation day 6 and 10. At day 10-12 Atrial Natriuretic Peptide, for vasoconstriction and dilation, strongly co-localized to uNK cells at the implantation sites. Expression of these vasoregulatory molecules by uNK suggests they contribute to the changes in blood pressure that occur between days 5 and 12 coincidental with their population explosion in the decidua during normal pregnancy.


Similar to Angiotensin, Bradykinin (BK) is produced from an inactive pre-protein kininogen that is activated by serine protease kallikrein (KLK), mostly represented on chromosome 19, where they associate with a number of other genes involved in blood pressure. Oakridge scientists predicted that BK induced a Covid19 "cytokine storm" that is responsible for disease progression. 

KLK's are located at 19q13.41, an active transposon region with a 2x background deletion rate clustered near Zinc Fingers and KIR's (Killer immunoglobulin like receptors) that inhibit NK cells.  A link was confirmed in mice uterine NK cells that regulated local tissue blood pressure, by at least AT1, partly in response to mechanical stretch of vasoconstriction and dilation induced by uterine NK's internal RAS. 

In reproduction, at  Chromosome 19 MiRNA Cluster (C19MC), 59 known miRNAs are highly expressed in human placentas and in the serum of pregnant women. Numerous C19MC miRNA's are also found in peripheral blood NK's and at least miR-517a-3p (a C19MC from fetal placenta) was incorporated into maternal NK cells in the third trimester, and was rapidly cleared after delivery. miRNA's also regulate the migration of human trophoblasts and suppress epithelial to mesenchymal transition (EMT) genes that are critical for maintaining the epithelial cytotrophoblast stem cell phenotype

In hepatocellular carcinoma (HCC) a co-regulatory network exists between C19MC miRNAs, melanoma-A antigens (MAGEAs), IFN-γ and p53 that promotes an oncogenic role of C19MC and is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 plays an antagonistic role. Its an important immunoregulartory network, because, in the very least, IFN-γ and IL6 have a major baring on the expression of HLA/MHC molecules on cancer cells. 

Immediately adjacent to C19MC, is the leukocyte immunoglobulin-like receptor complex, from where LILRB1 receptor, also known as Mir-7, is expressed on NK cells. It binds MHC class I molecules, on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. LILRB1 has a polymorphic regulatory region that enhances transcription in NK Cells and recruits zinc finger protein YY1 that inhibits p53. It is required to educate expanded human NK cells and defines a unique antitumor NK cell subset with potent antibody-dependent cellular cytotoxicity.

In 2019 a study of arsenite-induced, human keratinocyte transformation demonstrated that knockdown of m6A methyltransferase (METTL3) significantly decreased m6A level, restored p53 activation and inhibited phenotypes in the-transformed cells. m6A downregulated expression of positive p53 regulator, PRDM2, through YTHDF2-promoted decay of mRNAs. m6A also upregulated expression of negative p53 regulator, YY1 and MDM2 through YTHDF1-stimulated translation of YY1 and MDM2 mRNA. Taken together, the study revealed the novel role of m6A in mediating human keratinocyte transformation by suppressing p53 activation and sheds light on the mechanisms of arsenic carcinogenesis via RNA epigenetics.

In 2021 a discovery that YTHDF2 is upregulated in NK cells upon activation by cytokines, tumors, and cytomegalovirus infection. YTHDF2 maintains NK cell homeostasis and terminal maturation. It promotes NK cell effector function and is required for IL-15-mediated NK cell survival and proliferation by forming a STAT5-YTHDF2 positive feedback loop. Analysis showed significant enrichment in cell cycle, division, including mitotic cytokinesis, chromosome segregation, spindle, nucleosome, midbody, and chromosome. This data supports roles of YTHDF2 in regulating NK proliferation, survival, and effector functions. 

As part of the 2021 discovery, transcriptome-wide screening identified TDP-43 to be involved in cell proliferation or survival as a YTHDF2-binding target in NK cells. TDP-43 induces p53-mediated cell death of cortical progenitors and immature neurons. Growth of the developing cerebral cortex is controlled by Mir-7 through the p53 Pathway

Here we have broadly described mechanisms by which NK cells maintain tissue homeostasis where tightly regulated p53 optimizes cellular conditions to 'self' educate the expanded NK cells. Those that express NKG2A and/or one or several KIRs, for which cognate ligands are present, become educated and as such transform to potent killers in response to their missing-self. Therefore, p53 isoforms have the innate capacity to promote a cellular homeostasis that makes it the mediator for optimal education of expanded NK cells.


Tuesday, October 10, 2023

Cancer's HLA-G Backdoor


piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.



Wednesday, September 27, 2023

When Immunity Fails Programmed Cell Death

DNA Damage Response

Telomeric repeat (TR) sequences are responsible for genome integrity, where instability is a primary factor that leads to activation of p53. Introduction of a TR into cells leads to stabilization of p53, specific to TRs and not observed in plasmids containing non-TR sequences. TR-activated p53 exhibited enhanced transcriptional activity and induced p53-dependent growth suppression, measured as a reduction in colony formation. Sub-telomeric p53 binding prevents accumulation of DNA damage at human telomeres.  

Healthy cells experience thousands of DNA lesions per day. Micronuclei, containing broken fragments of DNA or chromosomes, that have become isolated, are recognized as one mediator of DNA damage response (DDR)-associated immune recognition. Like micronuclear DNA, mitochondrial DNA (mtDNA) is recognized by cGAS to drive STING-mediated inflammatory signaling. Mitochondrial damage can intersect DNA repair and inflammatory cascades with programmed cell death, through p53. In human fibroblasts and conditionally immortalized vascular smooth muscle cells p53 mediates CD54 (ICAM-1) overexpression in senescence.

Replicative senescence, an autophagy dependent program and crisis are anti-proliferative barriers that human cells must evade to gain immortality. Telomere-to-mitochondria signaling by ZBP1 mediates replicative crisis. Dysfunctional telomeres activate innate immune responses (IFN) through mitochondrial TR RNA (TERRA)–ZBP1 complexes. Senescence occurs when shortened telomeres elicit a p53 and RB dependent DNA-damage response. A crisis-associated isoform of ZBP1(innate immune sensor) is induced by the cGAS–STING DNA-sensing pathway, but reaches full activation only when associated with TERRA transcripts from dysfunctional telomeres. p53 utilizes the cGAS/STING innate immune system pathway for both cell intrinsic and cell extrinsic tumor suppressor activities. cGAS-STING activation induces the production of IFN-b and increases CD54 expression in  human cerebral microvascular endothelial cells.

In melanoma patients there is a significant correlation between cGAS expression levels and survival and between NK cell receptor expression levels and survival. Loss of cGAS expression by tumor cells could permit the tumor cell to circumvent senescence or prevent immunostimulatory NKG2D ligands expression. Loss of p53 and gain of oncogenic RAS exacerbated pro-malignant paracrine signaling activities of senescence-associated secretory phenotypes. Results imply that heterogeneity in cGAS activity, across tumors, could be an important predictor of cancer prognosis and response to treatment and suggest that NK cells could play an important role in mediating anti-tumor effects. Coculture of wild-type p53-induced human tumor cells with primary human NK cells enhanced NKG2D-dependent degranulation and IFN-γ production by NK cells. 

When p53 consensus sequences are modified and DNA damage response is compromised, replicative crisis ensues, mitochondrial membranes misfunction, mtDNA expression is downregulated and IFN signaling upregulates. A cell may then express activating immune ligands that bind NK receptors signaling non-self and cytolytic death or inhibitory receptors that signal self and immortality



Wednesday, May 17, 2023

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 


Thursday, October 20, 2022

Toward Customized Natural Killer Cells



An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  




Thursday, February 3, 2022

Expanding Treatment Horizons


An unrecognized link between p53 function and the immunosurveillance of cancer and infection led to an understanding how p53 influences the expression of MHC molecules at the cell surface via binding interaction with endoplasmic reticulum ERAP1.

Targeted mutations in multiple cancers revealed TP53 gene expression ranged between the 89th and 100th percentile of all expressed transcripts, and raised the possibility that p53 peptides arising from these common mutations might be immunogenic in these patients.

Select KIR-HLA composition favoring antitumor activity could be a promising immunotherapeutic strategy against breast cancer using autologous activated Natural Killer (NK) cell clones. Coexistence of inhibitory and activating killer-cell immunoglobulin-like receptors (KIR) to the same cognate HLA-C2 and HLA-Bw4 ligands conferred breast cancer risk. Inhibitory KIR(iKIR)-HLA pairs without their activating KIR (aKIR)-HLA counterparts were significantly higher in normal controls. Contrarily and adding complexity this suggests NK cells expressing iKIR, to cognate HLA-ligands in the absence of specific aKIR counterparts are instrumental in antitumor response

Identification and characterization of the peptides presented by HLA-C, G and E molecules has been lacking behind the more abundant HLA-A and HLA-B gene products. The peptide specificities of these HLA molecules were elucidated using a comprehensive analysis of naturally presented peptides. The 15 most frequently expressed HLA-C alleles as well as HLA-E*01:01 and HLA-G*01:01 were transfected into lymphoblastoid C1R B-cells expressing low endogenous HLA. 

The results (above) include allotype C*02:02 for p53 presentation and indicate the overlap of HLA source protein and top 500 peptides demonstrating the enormous complexity for multivariate analysis of immune response. However,  C*02:02 and C*05:01 have identical contact residues for p8 and p9, the residues of the bound peptide that influences HLA-C interaction with KIR. This suggests peptide effects could contribute to the broader and stronger binding reactions of these two HLA-C allotypes. Interestingly SART3 and MAGEA3 proteins both interact through the p53 pathway and are reported in the peptide study (above) in addition to TP53 to present ligands on C*02:02 and C*05:01. 

Moreover, in vitro  models demonstrated that p53 is required for upregulation of NK ligands. Further, there was a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma (BCC), with a higher likelihood that KIR B carriers harbor abnormal p53 (p<0.004). Together the data suggests functional interactions between KIR and HLA modify risks of BCC and Squamous Cell Carcinoma and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors.

Notwithstanding the enormous complexity between iKIR, aKIR - HLA interactions, immunoterapy must address the highly specific characteristics of autologous precision and discover methods to sensitively educate NK cells so that minimally invasive treatments can be extended to patients who fall outside the patient cohort for strictly regulated treatments. 

Of course, its never that simple...



Sunday, January 16, 2022

Evidence of Purposeful Evolution



Darwin's evolution challenged!

A recently published article in Nautre challenged evolution theory suggesting DNA repair was the more likely candidate driving evolutionary development than the environmental conditions thought to be the driver of natural selection. In some sense the two may be linked, but this study showed how epigenome-associated mutation bias reduced the occurrence of deleterious mutations, challenging the prevailing paradigm that mutation is a directionless force in evolution.

Quantitative assessment of DNA gain and loss through DNA double-strand break (DSB) repair processes suggests deletion-biased DSB repair causes ongoing genome shrinking in A. thaliana, whereas genome size in barley remained nearly constant.

Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DSB repair. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome.

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate Natural Killer (NK) cells are unable to express RAGs or RAG endonuclease activity during ontogeny. They exhibit a cell-intrinsic hyperresponsiveness, but a diminished capacity to survive following virus-driven proliferation, a reduced expression of DNA damage response mediators, and defects in the repair of DNA breaks. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors marks functionally distinct subsets of NK cells in the periphery, demonstrating a novel role for RAG in the functional specialization of the NK cell lineage. 

The most active region of Human Chromosome 19 has a long history of recombinations that define the expression patterns of telomeric and centromeric proportions of Killer-cell immunoglobulin-like receptor (KIR) gene's encoding receptors. KIR's bind cells presenting MHC class 1 HLA haplotype combinations, that vary significantly across tissues in different population groups. Further, the deletion rate in Zinc Finger clusters (ZNF) located around 19q13.42, near KIR and C19MC between 51,012,739 and 55,620,741 are about twofold higher than the background deletion rate. 

The relationship between deletions and mutation may indeed play a direct role in rapidly evolving, innate immunity. This may just begin to explain the speed at which global populations can respond and survive pandemics caused by the likes of COVID-19. And, the '19' in its nomenclature may go beyond time to the very chromosome responsible for innate immune diversity.









Thursday, April 22, 2021

IFN-γ Concentration, p53 and Immune Sensitivity

IFN-γ 

Dimorphic complexity between Human Leukocyte Antigen (HLA) and Killer Immune Receptor (KIR) haplotypes
introduce significant challenges for personalized Natural Killer (NK) and immune cell therapy. In vitro models support a p53 requirement for upregulation of NK ligands and there is a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma's (BCC) with a higher likelihood that KIR B carriers harbor abnormal p53. Data suggests that KIR encoded by B genes provides selective pressure for altered p53 in, at least BCC's. 

Breast cancer (BC) patients exhibit reduced NK-cytotoxicity in peripheral blood. To test whether certain KIR-HLA combinations impair NK-cytotoxicity that predispose to BC risk, KIR and HLA polymorphisms were analyzed in 162 women with BC and 278 controls. KIR-B genotypes increased significantly in BC. Certain activating KIR (aKIR) HLA ligand combinations were significantly increased in advanced-BC patients whose combinations also shared specific inhibitory KIR (iKIR) counterparts. Contrarily, iKIR-HLA pairs without their aKIR-HLA counterparts were significantly higher in controls. The data suggests NK cells expressing iKIR to cognate HLA-ligands in the absence of specific aKIR counterpart are instrumental in antitumor response. 

The TP53 family consists of three sets of transcription factor genes, TP53, TP63 and TP73, each expresses multiple RNA variants and protein isoforms. TP53 is mutated in 25-30% of BC's, but the effect of isoforms in BC is unknown. Predicted changes in expression of a subset of RNAs involved in IFN-γ signaling were confirmed in vitro. Data showed that different members of the TP53 family can drive transcription of genes involved in IFN-γ signaling in different BC subgroups. Moreover, tumors with low IFN-γ signaling were associated with significantly poorer patient outcome.

NK receptor NKG2D interacts with several virus or stress inducible ligands, including ULBP1 (NKG2DL1) and -2 expressed on target cells. Induction of wild-type p53, but not mutant p53, strongly upregulated mRNA and surface expression of ULBP1 and -2, but not other ligands. An intronic p53-responsive element was discovered in these genes. Coculture of wild-type, p53-induced human tumor cells with primary human NK cells enhanced NKG2D dependent degranulation and IFN-γ production by NK cells.  

In the Tumor Micro Environment (TME) IFN-γ is produced at various concentrations in response to numerous immune stimulants and highlights the need for more personalized, disease centric approach. Engagement of IFN-γ Receptor on distinct tumor stromal cells, induction of interferon stimulated genes, immune status of the TME, and IFN-γ concentration are recognized as critical determinants for IFN-γ-mediated outcomes. Notably, an appropriate antitumor concentration of IFN-γ has yet to be determined. Interestingly IFN-γ produced by NK cells is said to be an essential mediator of Angiotensin II inflammation and vascular dysfunction.

Pharmacological activation of p53 exerts a potent antileukemia effect on antitumor immunity, including NK cell-mediated cytotoxicity against acute myeloid leukemia (AML). Interestingly, orally administered DS-5272 (a potent inhibitor of MDM2 - promotor of p53 degradation) induced upregulation of CD107a and IFN-γ in NK cells but not in CD8+ T cells. Furthermore, coculture of NK cells with leukemia cells resulted in massive apoptosis. 

Findings strongly suggest an interaction between B7 (NK receptor) molecules contribute to a particular design of the inflammatory microenvironment including B7-H6 and PD-L1, for which therapy was enhanced by expanded NK autologous or donor cells. RNA transfections, into HeLa cells of p53 or BRCA1 intron1 Key Sequences (based on Codondex iScore's most significant mRNA-intron1 variations) caused several genes to be upregulated, +1500% above control including B7-H6 (NCR3LG1) ligand for NCR3 (Nkp30) NK cell receptor which, when engaged triggers IFN-γ release. NCR3 and soluble isoforms of Leukocyte Specific Transcript 1 may play a role in inflammatory and infectious diseases. 

Blockade of B7-H3 prolonged the survival of SKOV3 ovarian cancer cell, an in ovarian tumor-bearing mice, miR-29c improved the anti-tumor efficacy of NK-cell by directly targeting B7-H3. miR-29c downregulates B7-H3 and inhibits NK-cell exhaustion. Low levels of mir-29c have been associated with mutated p53 in BC patients. miR-29 miRNAs activate p53 by targeting p85α and CDC42 and upregulate p53 levels that induce apoptosis in a p53-dependent manner. miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting IFN-γ

Besides (intron predominant) human ALU repeats, reverse complementary sequences between introns bracketing circRNAs are highly enriched in RNA editing or hyper-editing events. Knockdown of double stranded RNA-editing enzyme - ADAR1 significantly and specifically upregulated circRNA expression. In its absence (interferon stimulating) oligoadenylate synthetase (OAS) can be activated by self-dsRNA (in contrast to viral dsRNA), resulting in RNase L activity and cell death. Conversely, OASL1 expression enhanced RIG-I-mediated IFN induction. In cells absent of p53, immunogenic, endogenous mitochondrial dsRNA are produced and processed by the OAS/RNase L system presenting a novel mechanism in diseases with aberrant immune responses. IFN-γ restores the impaired function of RNase L and induces mitochondria-mediated apoptosis in lung cancer. The p53—OAS axis, in mitochondrial RNA processing may prevent self-nucleic acid such as dsRNA from aberrantly activating innate immune responses.

A plethora of evidence supports bottom up approach to personalized therapy. A p53 intron1-mRNA regulatory loop, as a potential mechanism in IFN responses to infection and disease may be diagnostic. Pre-clinical research, presently underway will establish whether p53 is diagnostic for specific selections of a biopsy to educate NK cells and trigger effective immune response.



Monday, March 8, 2021

Custom Immunotherapy To Address Dimorphic Complexities.

Dimorphic relationships between genes on Chromosome (Chr)6, encoding Human Leukocyte Antigens (HLA) and those on Chr19, encoding Killer-cell immunoglobulin-like receptors (KIRs) may eventually uncover important information as to how, why and when Natural Killer (NK) cells determine self restraint or attack cells infected by pathogens and disease. These proteins emerge from their respective zones, on each chromosome that have and continue to be subject to frequent recombination events.


The active region of Chr19 has a long history of recombinations that have and continue to define the expression patterns of telomeric and centromeric proportions of KIR gene's encoding receptors that bind cells presenting MHC class 1, HLA haplotype combinations that vary significantly across tissues in different population groups. Adding complexity, HLA genes on Chr6 are also subject to significant recombination making the dimorphic functional HLA-KIR interactions difficult to predict. 

Studies across population groups reveal the great diversity of HLA-KIR dimorphisms. The Southern Han centromeric KIR region encodes strong, conserved, inhibitory HLA-C-specific receptors, and the telomeric region provides a high number and diversity of inhibitory HLA-A and -B-specific receptors. In all these characteristics, the Chinese Southern Han represent other East Asians, whose NK cell repertoires are thus enhanced in quantity, diversity, and effector strength, likely augmenting resistance to endemic viral infections.

One study goes much further suggesting that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered p53 in BCC tumors. This preference implicates multi-modal p53 mechanisms that are also known to upregulate NK ligands, induce HLA-A11 assembly against Epstein Bar Virus and bind a frequently mutated p53 peptide in a complex with HLA-A and presented at the cell surface that prevent T-Cell response. In support, selected p53 mutations altering protein stability can modulate p53 presentation to T cells, leading to a differential immune reactivity inversely correlated with measured p53 protein levels.

In addition to KIR, adaptive NKG2C+ NK cells display fine peptide specificity selectively to recognize HCMV strains that differed by a single substitution in the HLA-E-binding UL40-derived peptide during infection. Distinct peptides controlled the degree of proliferation in synergy with pro-inflammatory cytokines. Viral peptides are known to augment inhibition at NKG2A. Conversely, NKG2A+ NK cells sense MHC class I downregulation more efficiently than KIRs. Thus, both receptor:ligand systems appear to have complementary functions in recognizing changes in MHC class I.

Polymorphic landscapes across HLA, KIR and NKG receptor repertoires coupled with receptor:ligand haplotype cross referencing makes it near impossible to predict therapeutic targets across the breadth of disease and disease combinations that affect populations. A recent KIR-HLA co-existence study of haplotypes in Breast Cancer patients and controls highlights this complexity. 

Genetic signatures that target discovery of desired cell functionality to select preferential cells/tissues from micro environments used to educate and license autologous or allogeneic NK cells may tease specific, finely tuned, intact receptor repertoires. Once licensing efficacy is reached, expanding NK cell populations and applying them to act upon previously unrecognizable cells of a patient becomes the next frontier of immune therapy. This is the exciting work presently being undertaken by researchers and staff working with Precision Autology using Codondex methodologies. 



Monday, December 28, 2020

Natural Killers at the Neuro-Immune Axis!

Much has been said about the role Natural Killer (NK) cells play in positively and negatively influencing events in tissues and cells. Summarized facts about the healthy state of NK cells in humans and animals explain how innate immune cells, including NK cells differ from adaptive immune cells. One significant feature of NK cells is that they can act independently of MHC antigen presentations and that makes them tantalizing, but enormously challenging for scientists seeking to embrace their  influence over cells and their killing capabilities.

The variety and combination of inhibitory and activating receptors differentially expressed by as many as 30,000 human NK cell subsets makes heterogeneity difficult to relate across different conditions, organs and tissue types. Notwithstanding, positive rates of overall patient survival resoundingly corelated to the presence of as few as one NK cell infiltrating a tumor in a microscopic field.  

Innate immune cells including NK and macrophages have also been directly tied to conditions of neurological pain and more specifically to afferent and efferent fibers that signal through the vagus nerve. In these models at the immune-neurological interface similarities exists and both organs must interact for proper function. 

In each of these organs communication is mediated by direct cellular contact eg. synapse formation and via soluble mediators like cytokines or neurotransmitters that also communicate bi-directionally between cells of each system. The nervous and immune systems can influence each other’s activity because immune cells express neurotransmitter receptors, and neurons express cytokine receptors. Immune cells can synthesize and release neurotransmitters themselves, thus using neurotransmitter-mediated pathways via autocrine and paracrine mechanisms. This may indicate that NK cells extend nerve end signaling further into tissues and at a cellular level. 

A recent paradigm in physiology describes the existence of neuro-immune cell units, at an organ-tissue level and identifies the enormous complexity inherent in this globally unifying approach that also connects neuro-immune-gut, at least in Parkinson's disease.

Parkinson’s is a brain disorder where certain nerve cells slowly die and symptoms worsen. The risk of developing the condition increases with age, but in certain patients the illness is caused by defects in two proteins, PINK1 and parkin. NK cells are capable of homing to the central nervous system in neurological disorders that exhibit exacerbated inflammation and inhibit hyperactivated microglia. Recently, a study demonstrated that NK cells scavenge alpha-synuclein aggregates and systemic depletion of NK cells results in exacerbated neuropathology in a mouse model of alpha-synucleinopathy, making NK cells highly relevant in Parkinson’s disease.

We recently described a mechanism by which the sentinel state of NK cells is impaired and suggested the senescent phenotype, induced by age related mitophagy could be the primary cause. Increase in mitophagy (mitochondrial autophagy) is age-dependent and abrogated by PINK1 or parkin deficiency suggesting, in Parkinson's disease compromised mitophagy is associated with neurological degeneration. Further  PINK1 and Parkin, which are regulated by p53 specifically repress mitochondrial antigen presentation of both MHC classes. Therefore, excessive PINK1 or parkin increases rates of NK cell mitophagy and repress the presentation of mitochondrial antigens for MHC classes at the axis of this neuro-immune related disease.

The healthy state of NK cells at the axis of neuro-immune systems may indeed have more far reaching implications for the future of human diseases and therapies.

 












Monday, November 2, 2020

An Integrated P53 Puzzle - Glycolysis in Cancer, Diabetes and Immunity!

Oxygen poor hypoxic tissue promotes a cellular shift in mitochondrial metabolism from OXPHOS to less energy efficient glycolysis. Each shift induces environmental, epigenetic and genetic factors that alter a cells response to insult, attack and disease. Endothelial tip cells at micro-vessel ends are predominantly glycolytic. However, deletion of PFKFB3, the critical regulator of glycolysis reduced the sprouting of micro-vessel tips and elevated PFKFB3 levels improved tip cell sprouting, direction and cell behavior.

In response to DNA damage p53 promotes nucleotide biosynthesis by repressing the expression of PFKFB3. This increases the flux of glucose, through the pentose phosphate pathway (PPP) to increase nucleotide production, which results in more efficient repair of DNA damage and cell survival.

In Panc1 pancreatic cells, pro-apoptotic TGFβ1 enhanced PFKFB3 expression and stimulated glycolysis. Extracellular lactate induces endothelial mesenchymal transition (EMT) by remodeling the extracellular matrix and releasing activated TGFβ1.  TGFβ is a potent immunosuppressive cytokine that can impede development and function of natural killer (NK) and other immune cells. Furthermore, high extracellular lactate levels can contribute to immune evasion, thereby promoting tumor growth and metastasis. In tumor microenvironments glycolysis also leads to accumulated lactate, which stabilizes hypoxia inducible factor 1α (HIF-1) and upregulates the expression of anti-apoptotic, VEGF (in axis with NRP-1 dependency) resulting in angiogenesis and stimulation of cell migration. 


Hypoxia induces the loss of differentiation markers of several tumor types while increasing expression of embryonic markers such as transcription factors NANOG, OCT4, SOX2, and the Notch ligand. This reprogramming, toward a cancer stem phenotype is associated with increased tumorigenesis. In non-small cell lung carcinoma cells hypoxia increased NANOG expression that contributed to hypoxia-induced tumor cell resistance against cytotoxic lymphocyte (CTL)-mediated lysis.

Under stress the outer mitochondrial membrane incorporates Pink1, which binds and phosphorylates p53 at serine 392 and aids phagophore formation to enhance mitophagy. This reduces transport of p53-s392 to the nucleus where it would otherwise disrupt transcription of Nanog. p53 regulates Pink1 and Parkin, which regulate mitochondrial antigen presentation of both MHC classes. 

The development of type 1 diabetes involves a complex interaction between pancreatic β-cells and cells of the innate and adaptive immune systems. Analyses of the interactions between NK cells, NKT cells, dendritic cell populations and T cells have highlighted how these can influence the onset of autoimmunity. NK cells were observed in the pancreas, in NoD mice before T cell infiltration and are critically required in the pancreas for accelerated diabetes.

The islet in type 2 diabetes (T2D) is characterized by IAPP amyloid deposits, a protein co-expressed with insulin by β-cells. Human IAPP (hIAPP) misfolded protein stress activates HIF-1/PFKFB3 signaling, which increases glycolysis, mitochondrial fragmentation and perinuclear clustering, considered protective against increased cytosolic Ca2+, characteristic of amylin toxic oligomer stress. β-cells in adult humans are minimally replicative and fail to execute the second pro-regenerative phase of the HIF-1/PFKFB3 injury pathway. β-cells remain trapped in the pro-survival first phase of the HIF-1 injury repair response with a metabolism and mitochondrial network adapted to slow the rate of cell attrition at the expense of β-cell function. The senescent-like state may support the reduced NK cell activity and presence of more pro-inflammatory M1 macrophages in T2D

p53 deficient tumors can be metabolically reprogrammed and regressed by deleting isoforms of p63 or p73 to upregulate IAPP and amylin, which through the calcitonin receptor (CalcR) and receptor-activity-modifying-protein 3 (RAMP3) inhibit glycolysis, induce ROS and apoptosis. In epidermal keratinocytes p63 promotes glycolytic metabolism  by binding PFKFB3 consensus sites required for mRNA and protein expression.

Senescent cells typically upregulate anti-apoptotic pathways, and are preferentially susceptible to inhibition of these pro-survival mechanisms. This has been dubbed the ‘Achilles heel’ of senescent cells and may relate to the low mitochondrial membrane potential found in many senescent cells that ease the release of apoptosis-stimulating factors from mitochondria to promote survival. Similar weaknesses may be present through glycolysis in cancer, diabetes, other diseases and immune response.

Sunday, September 6, 2020

p53 in the SARS-CoV2 Storm

Coronavrius induced cytokine storm

A massive simulation and analysis using the supercomputer at Oakridge led scientists to more accurately identify the general idea that a Covid19 induced "cytokine storm" is responsible for disease progression. After detailed genetic analysis they specifically predicted that Bradykinin (BK) initiated the storm. If correct, this would help improve treatment directions for admitted patients. 

BK receptors are coded by BDKRB1 and BDKRB2 (BK2) gene's that operate in a kallikrein-kinin system (KKS), like the Renin Angiotensin System (RAS) as another potent regulator of blood pressure. BK is a part of the vasopressor system that induces hypotension and vasodilation, it is degraded by ACE and enhanced by angiotensin1-9, which is produced by ACE2 the receptor that SARS-COV2 binds. BK has been implicated as being active in the metabolic response to stress.

Similar to angiotensin peptides, BK is produced from an inactive pre-protein kininogen through activation by serine protease kallikrein (KKL). KLK1-KLK15 are mostly represented as a cluster of serine proteases on chromosome 19, with different tissue distributions. 

KLK's 1-15 further evidence a convergence on chromosome 19, associated closely with a large number of genes involved in blood pressure. KLK's are located at 19q13.41, an active transposon region with a 2x background deletion rate clustered near Zinc Fingers and KIR's (Killer cell like receptors). Chr19 is also associated with MHC precursors around which innate immunity and Natural Killer (NK) cell signaling developed. A link was confirmed in mice uterine NK cells that regulated local tissue blood pressure by at least Angiotensin Type 1 Receptor (AT1R) partly in response to mechanical stretch of vasoconstriction and vasodilation induced by uterine NK's internal RAS. 

A study of BK2 confirmed a conserved p53 binding site (rat, mouse and human) and p53-mediated activation of the BK2 promoter was augmented by transcriptional co-activators, CBP/p300. The results demonstrated BK2 promoter as a target of the p53-mediated activation and suggested a new physiological role for p53 in the regulation of G protein-coupled receptor (GPCR) gene expression. 

A follow up study, by the same group explained that Angiotensin II (AngII), the product of Angiotensin-Renin-Angiotensin1-Ace stimulates the phosphorylation of p53 (on serine 15) and CREB (on serine 133), and that AngII signaling converges on the p53-CRE enhancer to stimulate BK2 gene transcription.  

The convergence revealed that AT1R signaling activated CREB phosphorylation and in vivo assembly of p-CREB on the BK2 promoter in conjunction with histone hyperacetylation. It confirmed that AngII stimulates BK2 gene transcription in IMCD3 cells via AT1R. Thus, under conditions of augmented AngII and AT1R signaling, BK expression will be enhanced, thereby maintaining a balance of these two powerful counter-regulatory systems representing a novel form of cross-talk between GPCR's that link RAS and KKS, crucially here via p53.

This combined research indicates that activation of BK2 on endothelial cells, which is mediated by p53 dependent RAS-KKS cross-talk may also implicate AT1R on NK cells to secrete growth disrupting or growth promoting factors in response. SARS-CoV2 bound to ACE2 reduces its availability to convert angiotensin 1 to angiotensin 1-9, which normally enhances BK. The resulting imbalance and increase in circulating angII may directly implicate a NK cells' AT1R RAS response to a CoV2-ACE2 bound cell with disabled p53 promoter of GPCR expression. This cell with a crippled BK2 KKS, hypotension-vasodilation response offers no counter to the the AngII induced NK RAS vasoconstrictive function, affecting local tissue blood pressure thus failing to become a NK target.