Pathogens And Immunity - Mutual Memories

The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 

Cancer's HLA-G Backdoor

piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Evidence of Purposeful Evolution

Darwin's evolution challenged!

A recently published article in Nautre challenged evolution theory suggesting DNA repair was the more likely candidate driving evolutionary development than the environmental conditions thought to be the driver of natural selection. In some sense the two may be linked, but this study showed how epigenome-associated mutation bias reduced the occurrence of deleterious mutations, challenging the prevailing paradigm that mutation is a directionless force in evolution.

Quantitative assessment of DNA gain and loss through DNA double-strand break (DSB) repair processes suggests deletion-biased DSB repair causes ongoing genome shrinking in A. thaliana, whereas genome size in barley remained nearly constant.

Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DSB repair. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome.

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate Natural Killer (NK) cells are unable to express RAGs or RAG endonuclease activity during ontogeny. They exhibit a cell-intrinsic hyperresponsiveness, but a diminished capacity to survive following virus-driven proliferation, a reduced expression of DNA damage response mediators, and defects in the repair of DNA breaks. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors marks functionally distinct subsets of NK cells in the periphery, demonstrating a novel role for RAG in the functional specialization of the NK cell lineage. 

The most active region of Human Chromosome 19 has a long history of recombinations that define the expression patterns of telomeric and centromeric proportions of Killer-cell immunoglobulin-like receptor (KIR) gene's encoding receptors. KIR's bind cells presenting MHC class 1 HLA haplotype combinations, that vary significantly across tissues in different population groups. Further, the deletion rate in Zinc Finger clusters (ZNF) located around 19q13.42, near KIR and C19MC between 51,012,739 and 55,620,741 are about twofold higher than the background deletion rate. 

The relationship between deletions and mutation may indeed play a direct role in rapidly evolving, innate immunity. This may just begin to explain the speed at which global populations can respond and survive pandemics caused by the likes of COVID-19. And, the '19' in its nomenclature may go beyond time to the very chromosome responsible for innate immune diversity.

Retroviral Defense And Mitochondrial Offense

Chromosomal DNA has played host to the long game of viral insertions that repeat and continue as a genetic and epigenetic symbiosis along its phosphate and pentose sugar backbone. But, the bacterial origin of mitochondria and its hosted DNA also promotes its offense. 

Research suggests that retrovirus insertions evolved from a type of transposon called a retrotransposon. The evolutionary time scales of inherited, endogenous retroviruses (ERV) and the appearance of the zinc finger gene that binds its unique sequences occur over same time scales of primate evolution. Additionaly the zinc-finger genes that inactivate transposable elements are commonly located on chromosome 19. The recurrence of independent ERV invasions can be countered by a reservoir of zinc-finger repressors that are continuously generated on copy number variant (CNV) formation hotspots.

One of the more intiguing aspects of prevalent CNV hotspots on chromosome 19 are their proximity to killer immunoglobulin receptor gene's (KIR's) and other critical gene's of the innate immune system.

Frequently occuring DNA breaks can cause genomic instability, which is a hallmark of cancer. These breaks are over represented at G4 DNA quadruplexes within, hominid-specific, SVA retrotransposons and generally occur in tumors with mutations in tumor suppressor genes, such as TP53. Cancer mutational burden is shaped by G4 DNA, replication stress and mitochondrial dysfunction, that in lung adenocarcinoma downlregulates SPATA18, a mitochondrial eating protein (MIEAP) that contributes to mitophagy. 

Genetic variations, in non-coding regions can control the activity of conserved protein-coding genes resulting in the establishment of species-specific transcriptional networks. A chromosome 19 zinc finger, ZNF558 evolved as a suppressor of LINE-1 transposons, but has since been co-opted to singly regulate SPATA18. These variations are evident from a panel of 409 human lymphoblastoid cell lines where the lengths of the ZNF558 variable number tandem repeats (VNTR) negatively correlated with its expression. 

Colon cancer cells with p53 deletion were used to analyze deregulated p53 target genes in HCT116 p53 null cells compared to HCT116-p53 +/+ cells. SPATA18 was the most upregulted gene in the differential expression providing further insight to p53 and mitophagy via SPATA18-MIEAP.

p53 response elements (p53RE) can be shaped by long terminal repeats from endogenous retroviruses, long interspersed nuclear repeats, and ALU repeats in humans and fuzzy tandem repeats in mice. Further, p53 pervasively binds to p53REs derived from retrotransposons or other mobile genetic elements and can suppress transcription of retroelements. The p53- mediated mechanisms conferring protection from retroelements is also conserved through evolution. Certainly, p53 has been shown to have other roles in DNA  context, such as playing an important role in replication restart and replication fork progression. The absence of these p53-dependent processes can lead to further genomic instability. 

The frequency of variable length, long or short nucleotide repeats and their locations within a gene may be key to the repression of DNA sequences that would otherwise cause genomic instability or protein expressions that would eat bacterial mitochondria or destroy its cell host. 

The complexity of variable length insertions is made evident when exhaustively analyzing a simple length 12 sequence for the potential frequency of each of its variable length repeats starting from a minumum variable length of 8.

Then, for TGTGGGCCCACA(12)

All possible internal variable length combinations from and including length 8:

TGTGGGCC(8)|GTGGGCCC(8)|TGTGGGCCC(9)|TGGGCCCA(8)|GTGGGCCCA(9)|TGTGGGCCCA(10|GGGCCCAC(8)|TGGGCCCAC(9)|GTGGGCCCAC(10)|TGTGGGCCCAC(11)|GGCCCACA(8)|GGGCCCACA(9)|TGGGCCCACA(10)|GTGGGCCCACA(11)|TGTGGGCCCACA(12)

For example, reviewing length (8) only:

TGTGGGCC (8) occurs 5 times

GTGGGCCC (8) occurs 8 times

TGGGCCCA (8) occurs 9 times

GGGCCCAC (8) occurs 8 times

GGCCCACA (8) occurs 5 times

Any repeat can be ranked based on its ocurrence within all possible combinations of a given sequence, known as the repeats' iScore rank. This illustrates a potential useful statistical ranking that, subject to biology may describe a repeats inherency to be more or less effective, in increments of the gene sequence. 

Repression of the most active sequences, especially in context of repeats may result in genetic variation. 

Non-Coding DNA Key Sequences

DNA Structural Inherency

Wind two strands of elastic, eventually it will knot, ultimately it will double up on itself. Separate the strands. From the point of unwinding, forces will be directed to different regions and the separation will approximately return to the wound state of the band. Do the same with each of 10 different bands or strings of any type, they will all behave in much the same way. For a given section of DNA being transcribed, the effect of separation will be much the same. For a given gene, there will be sequences that can tolerate force to greater or lesser degrees. For different transcripts, of a gene variation at those sequences may be crucial to the integrity of transcription machinery that separates DNA strands to initiate replication to RNA and for the outcome.

Cellular biology is enormously complex in all regards. The physics of molecular interaction, fluid dynamics, and chemistry combine in a system where cause and effect is near impossible to predict. At the most elementary level we hypothesize some non-coding DNA (ncDNA) possess structural inherencies that can be deployed to direct gene proteins and cell function for diagnosis or therapy.

Coding DNA and its regulatory, non-coding gene compliment is transcribed and spliced from a transcribed gene. Transcription to RNA, edited mRNA, spliced non-coding RNA and ultimately mRNA translation to protein can produce wide ranging, variable outcomes that may not be re-captured experimentally. 

A single nucleotide polymorphism (SNP) or SNP combinations within a gene may affect the finely tuned balance that results. Under different environmental conditions this could be material to the protein produced. Additionally other mutations of the gene could add complexity to the environment and/or the  resulting protein translation. 

At this level of cellular biology, genetic DNA stores instruction for protein assemblies to produce new protein required for the fully functional cell. However, DNA's stored mutations can lead to different functional or non-functional versions of protein depending on many different factors. Relationships between ncDNA, including mutations and the transcripts' edited, protein coding mRNA may represent unexplored inherencies that can regulate the gene's mRNA or translated protein.

We built an algorithm to elaborately compare ncDNA sequences of multiple protein coding transcripts of the same gene. For each transcript it steps through every variable length ncDNA sequence (kmer) (specifically intron1), computes a signature for each and indexes it to the constant of the transcripts' mRNA signature. For each step these signatures order the kmers for each of the transcript's. The order is represented in a vector of all the transcripts being compared.  

At millions of successive steps (depending on total intron 1 length's) transcripts mostly retain their vector ordering except, as expected at a kmer length change. Mostly transcript order in the vector does not change, occasionally a few positions change, vary rarely do all positions change. Position changes that cause another, like a domino effect are filtered out. For the rarest positions changes at a step, we look to the root causes in the kmer (sequence). We call this a Key Sequence because it is identified by the significance of changes to transcript positions in the vector compared to the vector at the next step. 

Therefore, Key Sequences cause the most position changes between transcripts being compared by the algorithm. This relative measure is step dependent and Key Sequences are discovered by comparing transcript positions in the vector at the next step location. Logically, this infers a genes structural inherency discovered through ncDNA Key Sequence relationships to mRNA, to other transcripts, error in gene alignments, sequenced reads or the algorithm. 

In assay testing we were able to predict and synthesize non-coding RNA Key Sequences that significantly reduced proliferation of HeLa cells. In our pre-clinical work, based on comparisons to transcripts of the TP53 we will be predicting the efficacy of cell and tissue selections that educate and activate Natural Killer cells.

If Key Sequences are inherent they could open a new frontier for diagnosis and therapy.

Cell's with an Index like Google?

Its been a while since I last wrote about DNA repeats or their RNA descendants. In that time advanced research has emerged relating repeats to increasing numbers of viral or other disease. Generally the repeats of interest here can be either long or short sequences of nucleotides that from part of an unspliced gene. Logically, counts of long sequences that repeat would be less than short sequences, but when normalized to their respective nucleotide lengths the indexed results can shift the relative order of repeating sequences quite dramatically.

In most knowledge systems repeats in low level data present redundancy and opportunity to improve efficacy in local or global upstream processes acting on that data. We see this in the structure of efficient alphabets that had a significant impact on whether or not a language survived continuous use. Why use ten words when precise meaning, including abstracts can be derived from three. Or why alpha when, at least for some period in the language history alphanumeric made it more effective? 

Search engines reduce their primary index to the least redundant data set used to drive efficient data access by upstream requests and processes to satisfy any query. However, at the storage level, data redundancy is permitted because energy efficiency is gained. Similarly genetic DNA is massively redundant. Redundant data stores can make highly indexed systems more efficient because frequently accessed data elements are more accessible at multiple locations and parallel processes can more efficiently satisfy upstream requests.

Repetitive sequences constitute 50%–70% of the human genome. Some of these can transpose positions, these transposable elements (TE's) are DNA transposons and retrotransposons. The latter are predominant in most mammals and can be further divided into long terminal repeat (LTR)-containing endogenous retrovirus transposons and non-LTR transposons including short interspersed nuclear elements (SINEs) and long interspersed nuclear elements (LINEs). The most abundant subclass of SINEs comprises primate-specific Alu elements in human with more abundant GC-rich DNA. Humans have up to 1.4 million copies of these repeats, which constitute about 10.6% of the genomic DNA. Long interspersed element-1 (LINE1 or L1), are abundant in AT-rich DNA, constitute 19% of the human genome and make up the largest proportion of transposable element-derived sequences.

Most TE classes are primarily involved in reduced gene expression, but Alu elements are associated with up regulated gene expression. Intronic Alu elements are capable of generating alternative splice variants in protein-coding genes that illustrate how Alu elements can alter protein function or gene expression levels. Non-coding regions were found to have a great density of TEs within regulatory sequences, most notably in repressors. TEs have a global impact on gene regulation that indicates a significant association between repetitive elements and gene regulation.

In liquid systems, phase separation is one of the most fundamental phase transition phenomena and ubiquitous in nature. De-mixing of oil and water in salad dressing is a typical example. The discovery of biological phase separation in living cells led to the identification that phase-separation dynamics are controlled by mechanical relaxation of the network-forming dense phase, where the limiting process is permeation flow of the solvent for colloidal suspensions and heat transport for pure fluids. The application of this derived governing universal law is a step to understanding and defining the liquid biological indexing equivalence of data-processing systems and inherent genetic redundancy.

Repeats have been widely implicated. In plant immunity a TE has been domesticated through histone marks and generation of alternative mRNA isoforms that were both directly linked to immune response to a particular pathogen. p53 transcription sites evolved through epigenetic methylation, deamination and histone regulation that constituted a universal mechanism found to generate various transcription-factor binding sites in short TE's or Alu repeats. In disease cytoplasmic synthesis of Alu cDNA was implicated in age related macular degeneration and there is transient increase of nearly 20-fold in the levels of Alu RNA during stress, viral infection and cancer.

In chromosomal DNA, each sequence, relative to its length may conveniently describe a phase-separated indexed location and method for discovery. Repeats within genetic DNA may present precisely sensitive phase-separated guidance to drive histone, epigenetic and transcription factors to specific genetic locations at the cells' 'end-of-line' from where the genetic response to upstream membrane bound changes begin.