Showing posts with label alu. Show all posts
Showing posts with label alu. Show all posts

Saturday, March 14, 2026

Shared Regulatory Circuits in Pregnancy and Cancer


One of the more intriguing patterns in biology is that processes for normal development often resemble those that appear in disease. Few examples illustrate this better than the similarity between trophoblast invasion during pregnancy and the early stages of tumor growth.

In both situations, cells penetrate surrounding tissue, remodel blood vessels, and establish themselves within an environment that tolerates their presence rather than destroying them. The mechanisms that allow this to occur remain incompletely understood. Increasing evidence suggests that deubiquitinases (DUBs), enzymes that remove ubiquitin from proteins and thereby regulate signaling thresholds, may play an important role in stabilizing this permissive state.

This raises a provocative possibility: the regulatory machinery that enables the maternal–fetal interface to tolerate trophoblast invasion may share features with the mechanisms tumors exploit to evade immune detection.

During early pregnancy, decidual natural killer cells (dNK) become the dominant immune cell population in the uterus. Rather than behaving as cytotoxic killers, these cells adopt a distinct phenotype that supports; angiogenesis, spiral artery remodeling, trophoblast invasion.

The density of NK cells in the decidua is striking, often representing 50–70% of immune cells in early pregnancy. Instead of attacking invading trophoblasts, these NK cells participate in building the placenta and converting maternal spiral arteries into vessels capable of supporting fetal circulation.

Maintaining such a high density of NK cells without triggering immune destruction requires a carefully tuned balance between activation signals and inhibitory regulatory pathways. One of the central signals controlling NK cells in both peripheral tissues and the uterus is IL-15. In the decidua, IL-15 produced by stromal cells supports the recruitment, proliferation and survival of NK cells.

Recent work has identified YTHDF2, an m⁶A RNA-binding protein, as a key downstream regulator of this process. In NK cells: IL-15 → STAT5 → YTHDF2 → NK-cell homeostasis. YTHDF2 regulates the stability of specific mRNAs that determine NK survival, proliferation and maturation. Through selective RNA decay, YTHDF2 effectively tunes the functional state of NK cells.

A p53 regulatory layer likely intersects with this system. p53 is best known as a tumor suppressor that responds to DNA damage and cellular stress by regulating transcriptional programs controlling cell cycle arrest and apoptosis. But, p53 also plays an important role in immune signaling and communication between stressed cells and the immune system.

For example, p53 activation can influence immune surveillance by inducing chemokines and inflammatory mediators that recruit immune cells, including NK cells. This places p53 upstream of many of the stress-response pathways that determine whether an NK cell should eliminate a target.

p53, and repeat RNA constitute an innate sensing axis through a recently uncovered layer of regulation involving endogenous repetitive elements and innate immune sensing. Wild-type p53 helps suppress the activity of transposable elements such as LINE-1 and other repeat sequences. Loss or mutation of p53 can lead to derepression of these elements and the production of immunogenic nucleic acids. Many repetitive elements, including Alu sequences, can form double-stranded RNAs that activate innate immune sensors such as RIG-I and MDA5. Through these pathways, endogenous RNA molecules can mimic viral infection and activate interferon responses.

p53 also intersects with the cGAS–STING pathway, another major nucleic-acid sensing system. Wild-type p53 can promote activation of STING signaling by enabling cytosolic DNA accumulation through degradation of the nuclease TREX1. In contrast, mutant p53 can suppress STING signaling, helping tumors evade immune detection. Together these findings suggest that p53 may influence immune surveillance not only through classical stress pathways, but also through control of endogenous nucleic-acid signaling systems.

While RNA regulation shapes the NK-cell transcriptome, a second regulatory layer operates through ubiquitin signaling. Many proteins involved in immune activation are controlled by ubiquitination. Deubiquitinases (DUBs) reverse this process, stabilizing proteins or suppressing signaling cascades depending on the target. One DUB that has recently drawn attention is USP13 that has been shown to regulate several pathways central to immune signaling and cellular stress responses, including STING-dependent innate immune activation. Network analysis in prostate cancer datasets also show a strong interaction between USP13 and the RNA regulator YTHDF2, linking ubiquitin signaling to the RNA regulatory machinery governing NK cells. 

Interestingly, the relationship between NK cells and invasive cells is not unique to pregnancy. Studies show that NK cells often accumulate in tissues surrounding early tumors, particularly during the earliest stages of transformation. In many cancers, NK cells are present in peritumoral tissue, but become functionally suppressed or excluded as tumors progress. This pattern suggests that the immune system initially recognizes abnormal cells but may later be restrained by tumor-driven immunoregulatory mechanisms. The result is a paradox: NK cells are present but ineffective.

Taken together, these observations suggest a regulatory architecture that could stabilize environments where invasion must occur without triggering destructive immunity.

In such a system:

  1. Cellular stress signals activate p53 and generate stress-response transcripts.

  2. Endogenous repeat RNAs may activate innate immune sensing pathways such as RIG-I, MDA5 and STING.

  3. Cytokine signaling such as IL-15 supports NK-cell expansion and survival.

  4. RNA-level regulation via YTHDF2 tunes NK-cell gene expression and maturation.

  5. Deubiquitinases such as USP13 modulate innate immune signaling intensity and prevent excessive inflammatory activation.

The combined effect could be a high-NK-density but low-cytotoxic environment capable of supporting tissue remodeling and vascular development. In pregnancy, this environment enables trophoblast cells to invade maternal tissue and establish the placenta. Tumors may exploit the same architecture

Early tumors face a challenge similar to that encountered by trophoblasts: they must expand and invade tissue while avoiding immune elimination.

Many tumors exhibit features reminiscent of the decidual microenvironment, including; suppressed innate immune signaling, dysfunctional or tolerized NK cells, enhanced angiogenesis and extensive tissue remodeling.  If DUBs such as USP13 help establish these permissive states, tumors could potentially co-opt the same regulatory circuits that operate at the maternal–fetal interface.

In this view, tumors may hijack a developmental program that normally allows pregnancy to proceed successfully. 

The decidua represents one of the most extreme natural examples of immune tolerance in mammals. Understanding how this system maintains large NK-cell populations without triggering inflammation could reveal new strategies for controlling immune responses in other contexts.

If deubiquitinase signaling and p53-mediated nucleic-acid sensing help stabilize this balance, they may represent a broader biological principle; the same regulatory networks that enable successful pregnancy may also be exploited by tumors to evade immune detection.

Recent studies showing that rye-derived alkylresorcinols activate SIRT3-mediated autophagy and restore mitochondrial function suggest that metabolic stress regulation may sit upstream of the inflammatory and immune circuits that govern both trophoblast implantation and tumor invasion.

Uncovering these shared mechanisms could deepen our understanding of both reproductive biology and cancer immunology, and potentially reveal new therapeutic strategies in the process.

Saturday, January 17, 2026

Genome Balance: Repeats, Immunity, and Cancer


Cancer is usually described as a disease of mutations. Genes break, pathways fail, and cells escape control. That framing has been powerful, but it misses a deeper layer that may reveal how it begins.

The human genome is not primarily a coding genome. It is a repeat genome. More than half of our DNA consists of repetitive elements, with Alu retroelements alone numbering over a million copies. These sequences are a defining feature of primate genomes and they create a unique biological problem that human cells must continuously manage. Recent work suggests that cancer may emerge, in part, when this management system loses balance.

Alu elements are short retrotransposons that readily form double‑stranded RNA stem‑loop structures when transcribed, particularly in antisense orientation within introns and untranslated regions. To the innate immune system, these structures resemble viral RNA. This means that normal gene expression in human cells constantly risks triggering antiviral immune responses against self‑derived RNA.

A striking recent study shows that human cells rely on active suppression to avoid this outcome. In Ku suppresses RNA‑mediated innate immune responses in human cells to accommodate primate‑specific Alu expansion, the authors demonstrate that the DNA repair protein Ku (Ku70/Ku80) plays an essential second role: binding Alu‑derived dsRNA stem‑loops and preventing activation of innate immune sensors such as MDA5, RIG‑I, PKR, and OAS/RNase L.

When Ku is depleted interferon and NF‑κB signaling are strongly activated, translation is suppressed, and cells undergo growth arrest or death. Notably, Ku levels scale tightly with Alu expansion across primates, and Ku is essential in human cells but not in mice. The implication is clear:

Human cell viability depends on continuous suppression of Alu‑derived innate immune activation.

Alu expression is not harmless noise, it is actively tolerated! Ku functions as a finite buffer that allows primate cells to tolerate structurally immunogenic RNA produced by repeat‑rich genomes. When structured RNA load increases simultaneously from endogenous repeat transcription and exogenous viral RNA infection, Ku becomes functionally saturated and redistributed, weakening nuclear retention and cytoplasmic buffering. This pressurizes the cell’s capacity to contain dsRNA stress, promoting escape of repeat‑derived RNA, activation of innate sensors, and eventual selection for immune‑tolerant states.

A second line of evidence connects this tolerance to cancer evolution. A 2025 bioRxiv preprintp53 loss promotes chronic viral mimicry and immune tolerance, shows that loss of p53 permits transcription of immunogenic repetitive elements, generating signals that resemble viral infection. Rather than leading to effective immune clearance, this state becomes chronic. Tumor cells adapt by dampening innate immune responses and tolerating persistent repeat‑derived nucleic acids.

In this view, “viral mimicry” is not a one‑time immune alarm. It is a conditioning process repeat RNAs accumulate, immune pathways are activated, and progressively suppressed or rewired to allow survival. Cancer cells do not simply evade immunity, they learn to live with endogenous viral‑like signals.

These immune findings align with earlier evidence that repeat control begins at the level of genome structure itself. A 2022 Nature Communications study demonstrated that retroelements embedded within the first intron of TP53 act as cis‑repressive genomic architecture. Removing this intron increases TP53 expression, indicating that long‑embedded repeats contribute directly to regulating a core tumor suppressor gene.

Importantly, this repression is architectural rather than motif‑driven. The repeats do not act through a single conserved sequence, but through repeat‑dense structure.

Together, these findings suggest a layered system of control:

  1. Structural repression of repeats within introns.

  2. Immune suppression of repeat‑derived dsRNA.

  3. p53‑dependent governance of both genome stability and immune signaling. 

One long‑standing challenge in repeat biology is inconsistency. Different tumors show different repeat fragments. Even different regions of the same tumor can look unrelated at the sequence level.

From a traditional biomarker perspective, this appears discouraging. From a structural perspective, it is expected. Codondex analyses of repeat‑dense introns, including TP53 intron 1, show that cancer does not preserve specific Alu sequences. Instead, it perturbs repeat topology:

  • dominance and skew within intronic scaffolds,

  • stem‑loop‑prone architectures,

  • context‑specific fragmentation patterns.

The sequences vary. The instability regime does not. This is characteristic of a state change, not a discrete genetic event. Repeat‑dense introns behave like stress recorders. They integrate replication stress, chromatin relaxation, repair pathway bias, and immune tolerance history.

Unlike coding mutations, these signals are heterogeneous, region‑specific, and reflective of ongoing cellular state.

They are difficult to interpret with gene‑centric tools, but powerful when viewed architecturally. 

Most cancer diagnostics ask:

What mutation is present? A repeat‑aware framework asks:

Has this tissue entered a stable state of repeat derepression coupled with immune tolerance?

That state may precede aggressive behavior, accompany treatment resistance, or mark transitions in disease evolution. Future prognostic approaches may therefore combine repeat‑topology instability metricsrepeat RNA burden, and evidence of immune decoupling from dsRNA load. Not to identify a single driver, but to detect loss of containment.

Alu repeats do not cause cancer on their own, but human cells must continuously restrain them, structurally and immunologically. Cancer appears, at least in part, when that restraint erodes and tolerance replaces control. Introns, long treated as background, may be one of the clearest places to see this shift, not because they encode instructions, but because they actively record genomic history and project it into a measure of present state.


Saturday, January 3, 2026

How Mitochondria, p53, and ncRNAs Rule Metabolism and Innate Inflammation

The Informational Cell 

Inflammation and cellular homeostasis are not merely downstream reactions to stress; they are emergent properties of how cells process information. This information comes in the form of nucleic acids, DNA and RNA signals, originating from subcellular compartments. Recent advances reveal that the tumor suppressor p53, mitochondria, and non-coding RNAs (ncRNAs) integrate to form a unified system that links metabolism, innate immunity, and organelle integrity.

A deeper truth is emerging: Inflammation often begins as a problem of information misplacement. It arises when double-stranded RNA (dsRNA) appears in the cytosol, when DNA leaks outside the nucleus, or when telomeres can no longer contain their own signals.

Three foundational papers illuminate these intersections from different but complementary angles.

Nature Communications (2025): Reveals how p53 limits the formation of cytoplasmic chromatin fragments (CCF) in senescent cells, thereby putting a brake on inflammation.

Molecular Cell (2022): Demonstrates how endogenous RNA species, particularly from mitochondrial or nuclear sources, can trigger innate immune surveillance when they are released or de-sequestered.

Nature Cell Biology (2026): A landmark study showing that in senescent cells, p53 actively coordinates lipid metabolism to sustain membrane biosynthesis. It does this not by directly repairing DNA, but by increasing the recycling of phospholipid headgroups.

This final finding reframes p53 as a metabolic stabilizer. By linking membrane maintenance and autophagy-associated recycling to long-term survival, p53 ensures that membrane composition acts as a governor for organelle signaling and immune sensing.

When damaged or senescent cells begin leaking nuclear chromatin (especially telomeric DNA) into the cytoplasm, the cGAS–STING innate immune pathway is activated, sparking inflammatory transcription. p53 acts as a physiological brake on this process by promoting nuclear integrity and DNA repair. Crucially, mitochondria regulate how p53 senses the stress required to enforce this brake.

Similarly, p53 controls retrotransposon eruptions of RNA sequence repeats. Double-stranded RNA (dsRNA), normally a hallmark of viral infection, can emerge from within the cell when nuclear RNA-protein condensates are disturbed. These condensates normally sequester immunogenic dsRNA to prevent accidental immune triggering. When they dissolve due to stress, aging, or metabolic perturbation, endogenous dsRNA leaks out. It binds to innate immune sensors (such as RIG-I-like receptors), engaging a powerful antiviral response even in the absence of a virus.

In summary: DNA out of place -> activates cGAS–STING -> Inflammation. RNA out of place -> activates RIG-I/MAVS -> Inflammation.

Both are danger signals. Both provoke immune surveillance. And both can arise from mitochondrial transcriptional misregulation or organelle stress.

Mitochondria are not passive energy generators. With their bacterial ancestry, circular genome, and bidirectional transcription, they are uniquely capable of generating immunogenic RNA and dsRNA species. Under healthy conditions, mitochondrial RNAs are tightly sequestered. However, when mitochondrial dynamics or membrane integrity falter, these RNAs escape into the cytoplasm. There, they mimic viral RNA, activating MAVS-dependent signaling and innate immune programs.

This positions mitochondria as primary arbiters of inflammatory risk, not merely through reactive oxygen species or ATP imbalance, but through the containment of nucleic acids. p53 participates directly in this logic. By regulating mitochondrial quality control, autophagy, and lipid recycling, p53 indirectly determines whether mitochondrial RNAs remain silent or become inflammatory alarms.

If p53 is the brake and mitochondria are the engine, where do ncRNAs fit? They are the software: They adjust the sensitivity of innate sensors like RIG-I and MDA5, altering the threshold for danger responses. They serve as regulators of the RNA–protein condensates that sequester immunogenic RNA. They influence mitochondrial RNA processing and export, affecting the pool of dsRNA available for immune sensing. ncRNAs are not peripheral players; they determine how the cell interprets informational "noise", whether that noise is telomeric DNA fragments, mitochondrial dsRNA, or misprocessed nuclear transcripts.

This convergence suggests that chronic inflammation, aging, cancer immunity, and autoimmunity are not separate phenomena. They are tied together by how cells manage internal informational cues. In a world focused on therapeutic targets and biomarkers, the architecture of ncRNA and its interaction with p53 and mitochondria will define the next decade of precision immuno-metabolism.

Wednesday, February 19, 2025

P53 - Stability and Life Or Disorder and Death!

Chromosomal stability is central to good health, but the push and shove war of genesis, division, transcription, replication and restraint can promote disorder. Disruption can also be retained resulting in ageing, reduced organ function or diseases that often follow. Recently a man escaped his genetic predisposition, to becoming a victim of Alzheimer's disease, illustrating how far we are from understanding even the most well studied conditions. 

Active or passive, mobile Transposable Elements (TE) represent around 40-50% of the human genome and around 30% are found in the non-coding introns of genes. The first intron is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Our understanding of non-coding RNA (ncRNA) suggests one of its primary functions is the restraint of mobile TE's. Several species of ncRNA are associated with this restraint and genomic stability, most contain p53 binding sites that are also known to be involved in tumor suppression. 



Of the short ncRNA species, LINE-1 (L1), siRNAs are typically 21-23 nucleotides long and play a role in silencing L1 transcripts, thus preventing retro-transposition. p53 binds the L1 promoter to restrict autonomous copies of these mobile elements in human cells. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome. As little as 0.7% sequence divergence resulted in a significant reduction in recombination after double stranded breaks. piRNAs, usually 26-31 nucleotides, derived from Alu repeats restrain transposable elements. Endogenous Retroviruses (ERVs) can give rise to microRNAs (miRNAs) of 22 nucleotides, that can regulate the expression of ERV sequences and other cellular genes.  

TE's serve as templates for the generation of p53- binding-sites on a genome-wide scale . The formation of the p53 binding motifs was facilitated via methylation and deamination that distributes  p53-binding sites and recruits new target genes to its regulatory network in a species-specific manner. This p53 mechanism conducts genomic restraint, where instability and loss or mutation of p53 are commonly associated with hallmark's of cancer. 

Through a novel piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in Natural Killer (NK) cell lineage that may be broadly used in orchestrating immune development. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate NK cells are unable to express RAGs or RAG endonuclease activity during ontogeny. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors mark functionally distinct subsets of NK cells in the periphery, a surprising and novel role for RAG in the functional specialization of the NK cell lineage. 

The p53 C-terminal including amino acids 360-393 of the full-length protein locate to the mitochondrial permeability transition pore and facilitate apoptosis. However fragments of p53 at amino acid 1-186 and 22-186 drive the most mitochondrial depolarization. Crystal structures demonstrate amino acid 239 binds 106 and 241 binds 105 for one p53 unit and 243 binds 103-264-265 for a second unit, which are both are required to bind BCL-xl for apoptosis.

p53 regulates the expression of major histocompatibility complex (MHC) class I on cell surfaces. p53 peptides presented on HLA/MHC-I could attract immune surveillance as in the target-specific antitumor effects of p53 amino acids at positions 264-272, epitope 264scTCR with IL-2 on p53+/HLA-A2.1+ tumors that are primarily mediated by NK cells.  

Initially, NK cells might be activated due to the combined effect of reduced inhibition (due to decreased KIR3DL1) and increased activation signals from p53 epitopes. This NK cell activation could lead to the release of cytokines that not only enhance further NK activity but also attract and activate T cells. 

To summarize, p53 can influence both the presentation of its antigens through MHC-I and the regulation of NK cell inhibitory receptors like KIR3DL1 via piRNA. This could lead to a more effective immune response against cells with compromised p53 function, although the exact dynamics would depend on the specific context of cancer development, immune cell status, and individual genetic variations.

Tuesday, October 29, 2024

Pathogens And Immunity - Mutual Memories


The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 


Tuesday, October 10, 2023

Cancer's HLA-G Backdoor


piRNA actively control transposable elements (TE) that would otherwise disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV), a TE subclass, trigger fibro inflammation and play a role in kidney disease development. However, in mammals, the transcription of TEs is important for maintaining early embryonic development. piRNA also function with TE's for important aspects of Natural Killer (NK) cell immune development. Regardless of the cell type, endogenous retroviral elements of the ERV1 family, are highly enriched at p53 sites highlighting the importance of this repeat family in shaping the transcriptional network of p53.

HLA/MHC are highly polymorphic molecules, expressed on cells and recognized by NK cells. In mammals it is necessary to generate specialized NK cell subsets that are able to sense changes in the expression of each particular HLA molecule.

Decidual natural killer cells (dNK), the largest population of leukocytes at the maternal–fetal interface, have low cytotoxicity. They are believed to facilitate invasion of fetal HLA-G+ extravillous trophoblasts (EVT) into maternal tissues, essential for establishment of healthy pregnancies. dNK interaction with EVT leads to trogocytosis that acquires and internalizes HLA-G of EVT. dNK surface HLA-G was reacquired by incubation with EVT's. Activation of dNK by cytokines and/or viral products resulted in the disappearance of internalized HLA-G and restoration of cytotoxicity. Thus, the cycle provides both for NK tolerance and antiviral immune function by dNK.

A remote enhancer L, essential for HLA-G expression in EVT, describes the basis for its selective  immune tolerance at the maternal–fetal interface. Found only in genomes that lack a functional HLA-G classical promoter it raises the possibility that a retroviral element was co-opted during evolution to function in trophoblast-specific tolerogenic HLA/MHC expression. CEBP and GATA regulate EVT expression of HLA-G through enhancer L isoforms.

HLA-G1 is acquired by NK cells from tumor cells, within minutes, by activated, but not resting NK cells via trogocytosis. Once acquired, NK cells stop proliferating, are no longer cytotoxic and behave as suppressors of cytotoxic functions in nearby NK cells via the NK ILT2 (Mir-7) receptor. Mir-7 is a well researched intervention target in inflammatory diseases and belongs to a p53-dependent non-coding RNA network and MYC signaling circuit.

Cells that transcribe enhancer L isoforms and HLA-G, feed NK cells with HLA-G as an innate element for self determination, similar to the way EVT's restrain cytotoxicity of dNK. Then incoming, NK cells at the periphery of tumor microenvironments (TME) may promote vascular remodeling, as in the uterus during pregnancy, by acidifying the extracellular matrix with a2V that releases bound pro-angiogenic growth factors trapped in the extracellular matrix. After that these incoming NK cells succumb to the influence of Mir-7 resulting in low cytotoxic, inactive NK in the TME. 

Discovering resistant NK cells in the TME of a patient, for incubation, expansion and activation is a Codondex precision therapy objective based on p53 computations.



Saturday, August 19, 2023

Can Ancient Pathways Defeat Cancer?



It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 





Wednesday, May 17, 2023

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 


Sunday, January 16, 2022

Evidence of Purposeful Evolution



Darwin's evolution challenged!

A recently published article in Nautre challenged evolution theory suggesting DNA repair was the more likely candidate driving evolutionary development than the environmental conditions thought to be the driver of natural selection. In some sense the two may be linked, but this study showed how epigenome-associated mutation bias reduced the occurrence of deleterious mutations, challenging the prevailing paradigm that mutation is a directionless force in evolution.

Quantitative assessment of DNA gain and loss through DNA double-strand break (DSB) repair processes suggests deletion-biased DSB repair causes ongoing genome shrinking in A. thaliana, whereas genome size in barley remained nearly constant.

Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DSB repair. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome.

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate Natural Killer (NK) cells are unable to express RAGs or RAG endonuclease activity during ontogeny. They exhibit a cell-intrinsic hyperresponsiveness, but a diminished capacity to survive following virus-driven proliferation, a reduced expression of DNA damage response mediators, and defects in the repair of DNA breaks. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors marks functionally distinct subsets of NK cells in the periphery, demonstrating a novel role for RAG in the functional specialization of the NK cell lineage. 

The most active region of Human Chromosome 19 has a long history of recombinations that define the expression patterns of telomeric and centromeric proportions of Killer-cell immunoglobulin-like receptor (KIR) gene's encoding receptors. KIR's bind cells presenting MHC class 1 HLA haplotype combinations, that vary significantly across tissues in different population groups. Further, the deletion rate in Zinc Finger clusters (ZNF) located around 19q13.42, near KIR and C19MC between 51,012,739 and 55,620,741 are about twofold higher than the background deletion rate. 

The relationship between deletions and mutation may indeed play a direct role in rapidly evolving, innate immunity. This may just begin to explain the speed at which global populations can respond and survive pandemics caused by the likes of COVID-19. And, the '19' in its nomenclature may go beyond time to the very chromosome responsible for innate immune diversity.









Wednesday, November 17, 2021

Retroviral Defense And Mitochondrial Offense


Chromosomal DNA has played host to the long game of viral insertions that repeat and continue as a genetic and epigenetic symbiosis along its phosphate and pentose sugar backbone. But, the bacterial origin of mitochondria and its hosted DNA also promotes its offense. 

Research suggests that retrovirus insertions evolved from a type of transposon called a retrotransposon. The evolutionary time scales of inherited, endogenous retroviruses (ERV) and the appearance of the zinc finger gene that binds its unique sequences occur over same time scales of primate evolution. Additionaly the zinc-finger genes that inactivate transposable elements are commonly located on chromosome 19. The recurrence of independent ERV invasions can be countered by a reservoir of zinc-finger repressors that are continuously generated on copy number variant (CNV) formation hotspots.

One of the more intiguing aspects of prevalent CNV hotspots on chromosome 19 are their proximity to killer immunoglobulin receptor gene's (KIR's) and other critical gene's of the innate immune system.

Frequently occuring DNA breaks can cause genomic instability, which is a hallmark of cancer. These breaks are over represented at G4 DNA quadruplexes within, hominid-specific, SVA retrotransposons and generally occur in tumors with mutations in tumor suppressor genes, such as TP53. Cancer mutational burden is shaped by G4 DNA, replication stress and mitochondrial dysfunction, that in lung adenocarcinoma downlregulates SPATA18, a mitochondrial eating protein (MIEAP) that contributes to mitophagy. 

Genetic variations, in non-coding regions can control the activity of conserved protein-coding genes resulting in the establishment of species-specific transcriptional networks. A chromosome 19 zinc finger, ZNF558 evolved as a suppressor of LINE-1 transposons, but has since been co-opted to singly regulate SPATA18. These variations are evident from a panel of 409 human lymphoblastoid cell lines where the lengths of the ZNF558 variable number tandem repeats (VNTR) negatively correlated with its expression. 

Colon cancer cells with p53 deletion were used to analyze deregulated p53 target genes in HCT116 p53 null cells compared to HCT116-p53 +/+ cells. SPATA18 was the most upregulted gene in the differential expression providing further insight to p53 and mitophagy via SPATA18-MIEAP.

p53 response elements (p53RE) can be shaped by long terminal repeats from endogenous retroviruses, long interspersed nuclear repeats, and ALU repeats in humans and fuzzy tandem repeats in mice. Further, p53 pervasively binds to p53REs derived from retrotransposons or other mobile genetic elements and can suppress transcription of retroelements. The p53- mediated mechanisms conferring protection from retroelements is also conserved through evolution. Certainly, p53 has been shown to have other roles in DNA  context, such as playing an important role in replication restart and replication fork progression. The absence of these p53-dependent processes can lead to further genomic instability. 

The frequency of variable length, long or short nucleotide repeats and their locations within a gene may be key to the repression of DNA sequences that would otherwise cause genomic instability or protein expressions that would eat bacterial mitochondria or destroy its cell host. 

The complexity of variable length insertions is made evident when exhaustively analyzing a simple length 12 sequence for the potential frequency of each of its variable length repeats starting from a minumum variable length of 8.

Then, for TGTGGGCCCACA(12)

All possible internal variable length combinations from and including length 8:

TGTGGGCC(8)|GTGGGCCC(8)|TGTGGGCCC(9)|TGGGCCCA(8)|GTGGGCCCA(9)|TGTGGGCCCA(10|GGGCCCAC(8)|TGGGCCCAC(9)|GTGGGCCCAC(10)|TGTGGGCCCAC(11)|GGCCCACA(8)|GGGCCCACA(9)|TGGGCCCACA(10)|GTGGGCCCACA(11)|TGTGGGCCCACA(12)

For example, reviewing length (8) only:

TGTGGGCC (8) occurs 5 times

GTGGGCCC (8) occurs 8 times

TGGGCCCA (8) occurs 9 times

GGGCCCAC (8) occurs 8 times

GGCCCACA (8) occurs 5 times

Any repeat can be ranked based on its ocurrence within all possible combinations of a given sequence, known as the repeats' iScore rank. This illustrates a potential useful statistical ranking that, subject to biology may describe a repeats inherency to be more or less effective, in increments of the gene sequence. 

Repression of the most active sequences, especially in context of repeats may result in genetic variation. 








Thursday, May 13, 2021

Non-Coding DNA Key Sequences

DNA Structural Inherency

Wind two strands of elastic, eventually it will knot, ultimately it will double up on itself. Separate the strands. From the point of unwinding, forces will be directed to different regions and the separation will approximately return to the wound state of the band. Do the same with each of 10 different bands or strings of any type, they will all behave in much the same way. For a given section of DNA being transcribed, the effect of separation will be much the same. For a given gene, there will be sequences that can tolerate force to greater or lesser degrees. For different transcripts, of a gene variation at those sequences may be crucial to the integrity of transcription machinery that separates DNA strands to initiate replication to RNA and for the outcome.

Cellular biology is enormously complex in all regards. The physics of molecular interaction, fluid dynamics, and chemistry combine in a system where cause and effect is near impossible to predict. At the most elementary level we hypothesize some non-coding DNA (ncDNA) possess structural inherencies that can be deployed to direct gene proteins and cell function for diagnosis or therapy.

Coding DNA and its regulatory, non-coding gene compliment is transcribed and spliced from a transcribed gene. Transcription to RNA, edited mRNA, spliced non-coding RNA and ultimately mRNA translation to protein can produce wide ranging, variable outcomes that may not be re-captured experimentally. 

A single nucleotide polymorphism (SNP) or SNP combinations within a gene may affect the finely tuned balance that results. Under different environmental conditions this could be material to the protein produced. Additionally other mutations of the gene could add complexity to the environment and/or the  resulting protein translation. 

At this level of cellular biology, genetic DNA stores instruction for protein assemblies to produce new protein required for the fully functional cell. However, DNA's stored mutations can lead to different functional or non-functional versions of protein depending on many different factors. Relationships between ncDNA, including mutations and the transcripts' edited, protein coding mRNA may represent unexplored inherencies that can regulate the gene's mRNA or translated protein.

We built an algorithm to elaborately compare ncDNA sequences of multiple protein coding transcripts of the same gene. For each transcript it steps through every variable length ncDNA sequence (kmer) (specifically intron1), computes a signature for each and indexes it to the constant of the transcripts' mRNA signature. For each step these signatures order the kmers for each of the transcript's. The order is represented in a vector of all the transcripts being compared.  

At millions of successive steps (depending on total intron 1 length's) transcripts mostly retain their vector ordering except, as expected at a kmer length change. Mostly transcript order in the vector does not change, occasionally a few positions change, vary rarely do all positions change. Position changes that cause another, like a domino effect are filtered out. For the rarest positions changes at a step, we look to the root causes in the kmer (sequence). We call this a Key Sequence because it is identified by the significance of changes to transcript positions in the vector compared to the vector at the next step. 

Therefore, Key Sequences cause the most position changes between transcripts being compared by the algorithm. This relative measure is step dependent and Key Sequences are discovered by comparing transcript positions in the vector at the next step location. Logically, this infers a genes structural inherency discovered through ncDNA Key Sequence relationships to mRNA, to other transcripts, error in gene alignments, sequenced reads or the algorithm. 

In assay testing we were able to predict and synthesize non-coding RNA Key Sequences that significantly reduced proliferation of HeLa cells. In our pre-clinical work, based on comparisons to transcripts of the TP53 we will be predicting the efficacy of cell and tissue selections that educate and activate Natural Killer cells.

If Key Sequences are inherent they could open a new frontier for diagnosis and therapy.