Showing posts with label mrna. Show all posts
Showing posts with label mrna. Show all posts

Saturday, January 17, 2026

Genome Balance: Repeats, Immunity, and Cancer


Cancer is usually described as a disease of mutations. Genes break, pathways fail, and cells escape control. That framing has been powerful, but it misses a deeper layer that may reveal how it begins.

The human genome is not primarily a coding genome. It is a repeat genome. More than half of our DNA consists of repetitive elements, with Alu retroelements alone numbering over a million copies. These sequences are a defining feature of primate genomes and they create a unique biological problem that human cells must continuously manage. Recent work suggests that cancer may emerge, in part, when this management system loses balance.

Alu elements are short retrotransposons that readily form double‑stranded RNA stem‑loop structures when transcribed, particularly in antisense orientation within introns and untranslated regions. To the innate immune system, these structures resemble viral RNA. This means that normal gene expression in human cells constantly risks triggering antiviral immune responses against self‑derived RNA.

A striking recent study shows that human cells rely on active suppression to avoid this outcome. In Ku suppresses RNA‑mediated innate immune responses in human cells to accommodate primate‑specific Alu expansion, the authors demonstrate that the DNA repair protein Ku (Ku70/Ku80) plays an essential second role: binding Alu‑derived dsRNA stem‑loops and preventing activation of innate immune sensors such as MDA5, RIG‑I, PKR, and OAS/RNase L.

When Ku is depleted interferon and NF‑κB signaling are strongly activated, translation is suppressed, and cells undergo growth arrest or death. Notably, Ku levels scale tightly with Alu expansion across primates, and Ku is essential in human cells but not in mice. The implication is clear:

Human cell viability depends on continuous suppression of Alu‑derived innate immune activation.

Alu expression is not harmless noise, it is actively tolerated! Ku functions as a finite buffer that allows primate cells to tolerate structurally immunogenic RNA produced by repeat‑rich genomes. When structured RNA load increases simultaneously from endogenous repeat transcription and exogenous viral RNA infection, Ku becomes functionally saturated and redistributed, weakening nuclear retention and cytoplasmic buffering. This pressurizes the cell’s capacity to contain dsRNA stress, promoting escape of repeat‑derived RNA, activation of innate sensors, and eventual selection for immune‑tolerant states.

A second line of evidence connects this tolerance to cancer evolution. A 2025 bioRxiv preprintp53 loss promotes chronic viral mimicry and immune tolerance, shows that loss of p53 permits transcription of immunogenic repetitive elements, generating signals that resemble viral infection. Rather than leading to effective immune clearance, this state becomes chronic. Tumor cells adapt by dampening innate immune responses and tolerating persistent repeat‑derived nucleic acids.

In this view, “viral mimicry” is not a one‑time immune alarm. It is a conditioning process repeat RNAs accumulate, immune pathways are activated, and progressively suppressed or rewired to allow survival. Cancer cells do not simply evade immunity, they learn to live with endogenous viral‑like signals.

These immune findings align with earlier evidence that repeat control begins at the level of genome structure itself. A 2022 Nature Communications study demonstrated that retroelements embedded within the first intron of TP53 act as cis‑repressive genomic architecture. Removing this intron increases TP53 expression, indicating that long‑embedded repeats contribute directly to regulating a core tumor suppressor gene.

Importantly, this repression is architectural rather than motif‑driven. The repeats do not act through a single conserved sequence, but through repeat‑dense structure.

Together, these findings suggest a layered system of control:

  1. Structural repression of repeats within introns.

  2. Immune suppression of repeat‑derived dsRNA.

  3. p53‑dependent governance of both genome stability and immune signaling. 

One long‑standing challenge in repeat biology is inconsistency. Different tumors show different repeat fragments. Even different regions of the same tumor can look unrelated at the sequence level.

From a traditional biomarker perspective, this appears discouraging. From a structural perspective, it is expected. Codondex analyses of repeat‑dense introns, including TP53 intron 1, show that cancer does not preserve specific Alu sequences. Instead, it perturbs repeat topology:

  • dominance and skew within intronic scaffolds,

  • stem‑loop‑prone architectures,

  • context‑specific fragmentation patterns.

The sequences vary. The instability regime does not. This is characteristic of a state change, not a discrete genetic event. Repeat‑dense introns behave like stress recorders. They integrate replication stress, chromatin relaxation, repair pathway bias, and immune tolerance history.

Unlike coding mutations, these signals are heterogeneous, region‑specific, and reflective of ongoing cellular state.

They are difficult to interpret with gene‑centric tools, but powerful when viewed architecturally. 

Most cancer diagnostics ask:

What mutation is present? A repeat‑aware framework asks:

Has this tissue entered a stable state of repeat derepression coupled with immune tolerance?

That state may precede aggressive behavior, accompany treatment resistance, or mark transitions in disease evolution. Future prognostic approaches may therefore combine repeat‑topology instability metricsrepeat RNA burden, and evidence of immune decoupling from dsRNA load. Not to identify a single driver, but to detect loss of containment.

Alu repeats do not cause cancer on their own, but human cells must continuously restrain them, structurally and immunologically. Cancer appears, at least in part, when that restraint erodes and tolerance replaces control. Introns, long treated as background, may be one of the clearest places to see this shift, not because they encode instructions, but because they actively record genomic history and project it into a measure of present state.


Wednesday, August 13, 2025

Repeats as Signatures of Regulatory Potential


In the vast landscape of AI genomics, emerging analyses reveals non-coding DNA (ncDNA) as a treasure trove of regulatory information. At Codondex, our innovative k-mer-based approach uncovers how repetitive subsequences—short DNA fragments known as k-mers—serve as powerful signatures of regulatory potential. By viewing these repeats through a topological lens, we transform linear sequences into dynamic networks that highlight subtle distinctions in gene transcripts, offering new insights into gene regulation, isoform diversity, and disease mechanisms.

The Codondex Method: From Sequences to Topology

Codondex begins by "amplifying" ncDNA sequences associated with gene transcripts, generating all contiguous k-mers of length 8 or greater. For a gene like TP53, with its multiple isoforms (variants), we associate these k-mers with transcript-specific signatures derived from cDNA, mRNA or protein constants. The result? A rich dataset of subsequences, where repeats—identical k-mers appearing multiple times—emerge as key players.

Rather than treating DNA as a flat string, we interpret it topologically: k-mers as nodes in a graph, with repeats forming edges that indicate connections, clusters, and symmetries. Metrics like i-Score (normalizing contained k-mers by length) and inclusiveness (repeat frequency) rank these patterns, while cDNA or protein vectors capture fine distinctions. In our analyses of genes such as MEN1 and TP53, symmetries in repeat length and frequency stand out, unrelated to obvious features like reverse complements. These non-random patterns suggest repeats are not artifacts but deliberate signatures encoded for regulation.

Repeats as Regulatory Hotspots

How do these repeats signal regulatory potential? First, they often manifest as binding sites for proteins. Repetitive motifs can amplify affinity for transcription factors or splicing regulators. In TP53 introns, high-frequency k-mers align with p53-binding elements, potentially modulating tumor-suppressive isoforms. Variants with asymmetric repeats might weaken these interactions, leading to dysregulation in cancer.

Second, repeats influence secondary structures. Topologically, frequent repeats create "hubs" in the network, fostering DNA/RNA folds like hairpins that affect chromatin accessibility or mRNA stability. Our MEN1 intron1 study, analyzing 15 variants, revealed length-biased repeat clusters in scatter-graphs—despite length-agnostic algorithms—indicating structured motifs that differentiate stable from unstable transcripts. Disruptions from low-length repeats, as seen in TP53 vectors, act like regulatory "switches," fine-tuning expression in response to cellular stress.

Third, symmetries in repeats point to evolutionary conservation. Equal-length k-mers recurring with balanced frequencies form symmetric graphs, preserving robust modules across species. In MEN1, linked to endocrine tumors, these patterns suggest intron-driven adaptations for hormone regulation. Disruptions in variants could flag pathogenicity, enabling predictive modeling without coding-sequence reliance.

Real-World Implications and Validation

Our deep k-mer analysis, first detailed in a 2018 blog post, showcased MEN1 intron symmetries predicting protein outcomes, later validated through lab tests at Tel Aviv University. For TP53, stable vector positions disrupted by specific repeats correlated with isoform-specific roles, highlighting ncDNA's influence on cancer hallmarks.

This topological view empowers genomics: identifying regulatory elements for drug targeting, differentiating disease variants, and advancing precision medicine. At Codondex, we're excited to explore how these repeat signatures unlock ncDNA's secrets—join us in redefining genomic potential.


Wednesday, May 17, 2023

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 


Thursday, February 3, 2022

Expanding Treatment Horizons


An unrecognized link between p53 function and the immunosurveillance of cancer and infection led to an understanding how p53 influences the expression of MHC molecules at the cell surface via binding interaction with endoplasmic reticulum ERAP1.

Targeted mutations in multiple cancers revealed TP53 gene expression ranged between the 89th and 100th percentile of all expressed transcripts, and raised the possibility that p53 peptides arising from these common mutations might be immunogenic in these patients.

Select KIR-HLA composition favoring antitumor activity could be a promising immunotherapeutic strategy against breast cancer using autologous activated Natural Killer (NK) cell clones. Coexistence of inhibitory and activating killer-cell immunoglobulin-like receptors (KIR) to the same cognate HLA-C2 and HLA-Bw4 ligands conferred breast cancer risk. Inhibitory KIR(iKIR)-HLA pairs without their activating KIR (aKIR)-HLA counterparts were significantly higher in normal controls. Contrarily and adding complexity this suggests NK cells expressing iKIR, to cognate HLA-ligands in the absence of specific aKIR counterparts are instrumental in antitumor response

Identification and characterization of the peptides presented by HLA-C, G and E molecules has been lacking behind the more abundant HLA-A and HLA-B gene products. The peptide specificities of these HLA molecules were elucidated using a comprehensive analysis of naturally presented peptides. The 15 most frequently expressed HLA-C alleles as well as HLA-E*01:01 and HLA-G*01:01 were transfected into lymphoblastoid C1R B-cells expressing low endogenous HLA. 

The results (above) include allotype C*02:02 for p53 presentation and indicate the overlap of HLA source protein and top 500 peptides demonstrating the enormous complexity for multivariate analysis of immune response. However,  C*02:02 and C*05:01 have identical contact residues for p8 and p9, the residues of the bound peptide that influences HLA-C interaction with KIR. This suggests peptide effects could contribute to the broader and stronger binding reactions of these two HLA-C allotypes. Interestingly SART3 and MAGEA3 proteins both interact through the p53 pathway and are reported in the peptide study (above) in addition to TP53 to present ligands on C*02:02 and C*05:01. 

Moreover, in vitro  models demonstrated that p53 is required for upregulation of NK ligands. Further, there was a strong association between the KIR B haplotype and p53 alteration in Basal Cell Carcinoma (BCC), with a higher likelihood that KIR B carriers harbor abnormal p53 (p<0.004). Together the data suggests functional interactions between KIR and HLA modify risks of BCC and Squamous Cell Carcinoma and that KIR encoded by the B genes provide selective pressure for altered p53 in BCC tumors.

Notwithstanding the enormous complexity between iKIR, aKIR - HLA interactions, immunoterapy must address the highly specific characteristics of autologous precision and discover methods to sensitively educate NK cells so that minimally invasive treatments can be extended to patients who fall outside the patient cohort for strictly regulated treatments. 

Of course, its never that simple...



Wednesday, November 17, 2021

Retroviral Defense And Mitochondrial Offense


Chromosomal DNA has played host to the long game of viral insertions that repeat and continue as a genetic and epigenetic symbiosis along its phosphate and pentose sugar backbone. But, the bacterial origin of mitochondria and its hosted DNA also promotes its offense. 

Research suggests that retrovirus insertions evolved from a type of transposon called a retrotransposon. The evolutionary time scales of inherited, endogenous retroviruses (ERV) and the appearance of the zinc finger gene that binds its unique sequences occur over same time scales of primate evolution. Additionaly the zinc-finger genes that inactivate transposable elements are commonly located on chromosome 19. The recurrence of independent ERV invasions can be countered by a reservoir of zinc-finger repressors that are continuously generated on copy number variant (CNV) formation hotspots.

One of the more intiguing aspects of prevalent CNV hotspots on chromosome 19 are their proximity to killer immunoglobulin receptor gene's (KIR's) and other critical gene's of the innate immune system.

Frequently occuring DNA breaks can cause genomic instability, which is a hallmark of cancer. These breaks are over represented at G4 DNA quadruplexes within, hominid-specific, SVA retrotransposons and generally occur in tumors with mutations in tumor suppressor genes, such as TP53. Cancer mutational burden is shaped by G4 DNA, replication stress and mitochondrial dysfunction, that in lung adenocarcinoma downlregulates SPATA18, a mitochondrial eating protein (MIEAP) that contributes to mitophagy. 

Genetic variations, in non-coding regions can control the activity of conserved protein-coding genes resulting in the establishment of species-specific transcriptional networks. A chromosome 19 zinc finger, ZNF558 evolved as a suppressor of LINE-1 transposons, but has since been co-opted to singly regulate SPATA18. These variations are evident from a panel of 409 human lymphoblastoid cell lines where the lengths of the ZNF558 variable number tandem repeats (VNTR) negatively correlated with its expression. 

Colon cancer cells with p53 deletion were used to analyze deregulated p53 target genes in HCT116 p53 null cells compared to HCT116-p53 +/+ cells. SPATA18 was the most upregulted gene in the differential expression providing further insight to p53 and mitophagy via SPATA18-MIEAP.

p53 response elements (p53RE) can be shaped by long terminal repeats from endogenous retroviruses, long interspersed nuclear repeats, and ALU repeats in humans and fuzzy tandem repeats in mice. Further, p53 pervasively binds to p53REs derived from retrotransposons or other mobile genetic elements and can suppress transcription of retroelements. The p53- mediated mechanisms conferring protection from retroelements is also conserved through evolution. Certainly, p53 has been shown to have other roles in DNA  context, such as playing an important role in replication restart and replication fork progression. The absence of these p53-dependent processes can lead to further genomic instability. 

The frequency of variable length, long or short nucleotide repeats and their locations within a gene may be key to the repression of DNA sequences that would otherwise cause genomic instability or protein expressions that would eat bacterial mitochondria or destroy its cell host. 

The complexity of variable length insertions is made evident when exhaustively analyzing a simple length 12 sequence for the potential frequency of each of its variable length repeats starting from a minumum variable length of 8.

Then, for TGTGGGCCCACA(12)

All possible internal variable length combinations from and including length 8:

TGTGGGCC(8)|GTGGGCCC(8)|TGTGGGCCC(9)|TGGGCCCA(8)|GTGGGCCCA(9)|TGTGGGCCCA(10|GGGCCCAC(8)|TGGGCCCAC(9)|GTGGGCCCAC(10)|TGTGGGCCCAC(11)|GGCCCACA(8)|GGGCCCACA(9)|TGGGCCCACA(10)|GTGGGCCCACA(11)|TGTGGGCCCACA(12)

For example, reviewing length (8) only:

TGTGGGCC (8) occurs 5 times

GTGGGCCC (8) occurs 8 times

TGGGCCCA (8) occurs 9 times

GGGCCCAC (8) occurs 8 times

GGCCCACA (8) occurs 5 times

Any repeat can be ranked based on its ocurrence within all possible combinations of a given sequence, known as the repeats' iScore rank. This illustrates a potential useful statistical ranking that, subject to biology may describe a repeats inherency to be more or less effective, in increments of the gene sequence. 

Repression of the most active sequences, especially in context of repeats may result in genetic variation. 








Sunday, June 20, 2021

First Intron DNA - Site for a Genetic Brain?

DNA Methylation

The first intron of a gene, regardless of tissue or species is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Therefore, it is an informative gene feature regarding the relationship between DNA methylation and gene expression. But, expression in induced pluripotent stem cells (iPSC's) has been a major challenge to the stem cell industry, because by comparison these cells have not yet reached the state of natural pluripotent or embryonic stem cells (ESC's).

In mice two X chromosomes (XC) are active in the epiblasts of blastocysts as well as in pluripotent stem cells. One XC is inactivated triggered by Xist (non coding) RNA transcripts coating it to become silent. Designer transcription factor (dTF) repressors, binding the Xist intron 1 enhancer region caused higher H3K9me3 methylation and led to XC's opening and X-linked gene repression in MEFs. This substantially improved iPSC production and somatic cell nuclear transfer (SCNT) preimplantation embryonic development. This also correlated with much fewer abnormally expressed genes frequently associated with SCNT, even though it did not affect Xist expression. In stark contrast, the dTF activator targeting the same enhancer region drastically decreased both iPSC generation and SCNT efficiencies and induced ESC differentiation. 

A genome-wide, tissue-independent quasi-linear, inverse relationship exists between DNA methylation of the first intron and gene expression. More tissue-specific, differentially methylated regions exist in the first intron than in any other gene feature. These have positive or negative correlation with gene expression, indicative of distinct mechanisms of tissue-specific regulation. CpGs in transcription factor binding motifs are enriched in the first intron and methylation tends to increase with distance from the first exon–first intron boundary, with a concomitant decrease in gene expression.

Since the relationship between sequence, methylation, repression and transcription is determinative in ESC differentiation it may also suggest a broader link to differential translation. Translation is required for miRNA-dependent transcript destabilization that alters levels of coding and noncoding transcripts. But, steady-state abundance and decay rates of cytosolic long non-coding RNA's (lncRNAs) are insensitive to miRNA loss. Instead lncRNAs fused to protein-coding reporter sequences become susceptible to miRNA-mediated decay. 

In this model, first intron DNA sequences that are differentially methylated, bind transcription factors that effect transcription, impact splicing, expressions of coding or non-coding transcripts and transcript destabilizations resulting in differential rates and possible variations in translation. This bottom-up, dynamic view of the classical process may elevate the first intron from 'junk' to a DNA 'brain' because it plays a more extensive role, heading the process toward translation of any gene or switching it off entirely.  

For this reason, among others Codondex uses first intron k-mers relative to the transcripts mRNA as the basis for comparing same gene transcripts in diseased cells or tissue samples. Further, p53 and BRCA1 miRNA key sequences, discovered using Codondex iScore algorithm, when transfected into HeLa cells resulted in significantly reduced proliferation that may result from this accelerated, transfected miRNA dependent decay.

 

Tuesday, June 1, 2021

Short Sequences of Proximally Disordered DNA

Oxford Nanopore Device Reducing Sequencing Cost

Relationships exist between short sequences of proximal DNA (SSPD) of a gene that when transcribed into RNA present stronger or weaker binding attractions to RNA binding proteins (RBP'S) that settle, edit, splice and resolve messenger RNA (mRNA). Responsive to epigenetic stimuli on Histones and DNA, mRNA are constantly transcribed in different quantity, at different times such that different mRNA strands are transported from the nucleus to cytoplasm where they are translated into and produce any of more than 30,000 different proteins.

Single nucleotide polymorphisms and DNA mutations can alter SSPD combinations in different diseased cells thus altering sequence proximity, ordering that affects transcribed RNA's attraction and optimal binding of RBP's. This may result in modified splicing of RNA, assembly of mRNA and slight or major variations in some or all translated protein derived from that gene. 

The specific effects of these DNA variations, on the multitude of proteins produced are generally unknown. However, it remains important to understand their effects in disease, diagnosis and therapy. Typically these have historically been researched by large scale analysis of RBP on RNA as opposed to the more fundamental, yet underrepresented massive array of diseased variant DNA to mRNA transitions.

Most pharmaceutical research is directed to a molecular interference targeting an aberrant protein to cure widely represented or highly impactful disease conditions of society. Economic assessments generally influence government decisions to support research based on loss of GDP contribution by a specific disease in a  patient cohort. However, in the modern multi-omics era top down research into protein-RNA activity is descending deeper into the cell to include RNA-mRNA and mRNA-DNA customizable therapies that will eventually resolve individually assessed diseases at a price that addresses much larger array of patient needs.  

SNP's and other mutations can vary considerably in cells. These variations can cause instability during division and lead to translated differences that can ultimately drive cancerous cell growth to escape patient immunity. Like a 'whack-a-mole' game, pattern variation and mechanistic persistence eventually beat the player. Without effective immune clearance these cells can replicate into tumors and contribute to microenvironments that support their existence.

Link to video on tumor microenvironment https://youtu.be/Z9H2utcnBic

We thought to analyze DNA and mRNA transcripts from cells in tumors and their microenvironments to see if we could expose the SSPD disordered combinations that may have promoted sub-optimal RBP attractions and led to sustained immune escape. Given the complexity of DNA to mRNA transcription, for any given gene many distortions in gene data sets have to be filtered. To do that we focused on p53, the most mutated gene in cancer. We designed a method to compare sequences arrays of DNA and mRNA Ensembl transcripts, from the consensus of healthy patients to multiple cell samples extracted from different sections of a patients tumor and tumor microenvironment.     

We previously identified and measured different levels of Natural Killer (NK) cell cytotoxicity, produced from cocultures with the extracted samples of each of the multiple sites of a biopsy. We will measure the different p53 transcript SSPD combinations associated with each sample and determine whether disordered SSPD's corelate with NK cytotoxicity from each coculture. We expect to identify whether biopsied tumor cells, ranked by SSPD's predict the cytotoxicity resulting from NK cell cocultures. We will narrow our research to identify the varied expressions of receptor combinations associated with degrees of cytotoxicity. We will test immune efficacy to lyse and destroy tumor cells. Finally we will test for adaptive immune response. 

Our vision is for per-patient, predictable cell co-culture pairings, for innate immune cell education based on ranking DNA-mRNA combinations to lead to multiple effective therapies. The falling cost of sequencing and sophistication of GMP laboratories presently servicing oncologists may support a successful use of this analytical approach to laboratory assisted disease management.

   



 

Thursday, May 13, 2021

Non-Coding DNA Key Sequences

DNA Structural Inherency

Wind two strands of elastic, eventually it will knot, ultimately it will double up on itself. Separate the strands. From the point of unwinding, forces will be directed to different regions and the separation will approximately return to the wound state of the band. Do the same with each of 10 different bands or strings of any type, they will all behave in much the same way. For a given section of DNA being transcribed, the effect of separation will be much the same. For a given gene, there will be sequences that can tolerate force to greater or lesser degrees. For different transcripts, of a gene variation at those sequences may be crucial to the integrity of transcription machinery that separates DNA strands to initiate replication to RNA and for the outcome.

Cellular biology is enormously complex in all regards. The physics of molecular interaction, fluid dynamics, and chemistry combine in a system where cause and effect is near impossible to predict. At the most elementary level we hypothesize some non-coding DNA (ncDNA) possess structural inherencies that can be deployed to direct gene proteins and cell function for diagnosis or therapy.

Coding DNA and its regulatory, non-coding gene compliment is transcribed and spliced from a transcribed gene. Transcription to RNA, edited mRNA, spliced non-coding RNA and ultimately mRNA translation to protein can produce wide ranging, variable outcomes that may not be re-captured experimentally. 

A single nucleotide polymorphism (SNP) or SNP combinations within a gene may affect the finely tuned balance that results. Under different environmental conditions this could be material to the protein produced. Additionally other mutations of the gene could add complexity to the environment and/or the  resulting protein translation. 

At this level of cellular biology, genetic DNA stores instruction for protein assemblies to produce new protein required for the fully functional cell. However, DNA's stored mutations can lead to different functional or non-functional versions of protein depending on many different factors. Relationships between ncDNA, including mutations and the transcripts' edited, protein coding mRNA may represent unexplored inherencies that can regulate the gene's mRNA or translated protein.

We built an algorithm to elaborately compare ncDNA sequences of multiple protein coding transcripts of the same gene. For each transcript it steps through every variable length ncDNA sequence (kmer) (specifically intron1), computes a signature for each and indexes it to the constant of the transcripts' mRNA signature. For each step these signatures order the kmers for each of the transcript's. The order is represented in a vector of all the transcripts being compared.  

At millions of successive steps (depending on total intron 1 length's) transcripts mostly retain their vector ordering except, as expected at a kmer length change. Mostly transcript order in the vector does not change, occasionally a few positions change, vary rarely do all positions change. Position changes that cause another, like a domino effect are filtered out. For the rarest positions changes at a step, we look to the root causes in the kmer (sequence). We call this a Key Sequence because it is identified by the significance of changes to transcript positions in the vector compared to the vector at the next step. 

Therefore, Key Sequences cause the most position changes between transcripts being compared by the algorithm. This relative measure is step dependent and Key Sequences are discovered by comparing transcript positions in the vector at the next step location. Logically, this infers a genes structural inherency discovered through ncDNA Key Sequence relationships to mRNA, to other transcripts, error in gene alignments, sequenced reads or the algorithm. 

In assay testing we were able to predict and synthesize non-coding RNA Key Sequences that significantly reduced proliferation of HeLa cells. In our pre-clinical work, based on comparisons to transcripts of the TP53 we will be predicting the efficacy of cell and tissue selections that educate and activate Natural Killer cells.

If Key Sequences are inherent they could open a new frontier for diagnosis and therapy.