Sunday, March 2, 2025

Transposons mitochondria, piRNA, p53, NK precursors and immunity

 

Key Points

  • p53 helps control transposons, mobile DNA, and may regulate piRNA, small RNAs that silence them.

  • piRNA influences NK cell development, linking transposon control to immunity.

  • p53 play a role in NK cell maturation and boosting immune responses like interferon signaling.

Direct Answer

Overview

Transposons, or "jumping genes," can move within our DNA and potentially cause issues, so their control is crucial. The protein p53, known as the "guardian of the genome," seems to play a big role in keeping them in check. It might also influence piRNA, tiny RNA molecules that help silence transposons. These piRNAs may also affect the development of NK cell precursors, which are early stages of natural killer cells, important for our immune system. p53 also appears to help NK cells mature and boost immunity through processes like interferon signaling. This creates a web of connections where controlling transposons could impact our immune health, especially in diseases like cancer.

p53 and Transposon Control

p53 binds to transposon promoters, like those of L1 elements, to limit their activity, helping maintain genomic stability. It may also regulate piRNA, adding another layer of control. For example, studies show p53 restricts L1 retrotransposons, which make up about 17% of our genome, with around 100 still able to move (Genetic Eruption and p53 Response).


piRNA's Role

piRNA, typically 26-31 nucleotides long, silences transposons and seems to influence NK cell function by regulating genes like KIR3DL1, which are crucial for immune responses. This means piRNA links transposon control to NK cell activity, potentially affecting immunity.

NK Cells and Immunity

NK cell precursors develop into NK cells, which fight infections and cancer. p53 is involved in their maturation, and it also enhances interferon signaling and MHC class I expression, both vital for immune recognition. For instance, p53 peptides at positions 264-272 can attract immune surveillance, boosting NK and T cell activity (p53 Stability and Life or Disorder and).

Unexpected Detail: Metabolic Links

An interesting connection is how mitochondria, our cell's powerhouses, influence piRNA function and transposon control through energy and ROS levels. This could indirectly affect NK cells and immunity, adding a metabolic layer to these relationships (Electrons Rule Your Biology).


Survey Note: Detailed Analysis of Relationships

This section provides a comprehensive exploration of the potential relationships between transposon control, p53, piRNA, NK cell precursors, and immunity, drawing from detailed blog posts dated from 2021 to 2025. The analysis aims to mimic a professional scientific review, offering a strict superset of the direct answer content, with tables for clarity and inline URLs for references.

Background and Context

Transposons, or transposable elements (TEs), constitute 40-50% of the human genome, with 30% located in non-coding introns, and are known for their potential to disrupt genes and cause genomic instability (p53 Stability and Life or Disorder and). Their control is vital, and research suggests p53, a tumor suppressor protein, plays a central role. piRNA, small non-coding RNAs of 26-31 nucleotides, are key in silencing TEs, while NK cell precursors develop into natural killer cells, critical for innate immunity. The interplay between these elements and immunity, particularly through p53 and piRNA, is complex and warrants detailed examination.

Detailed Relationships

p53 and Transposon Control

p53 is implicated in restraining transposon mobility, particularly L1 (LINE1) retrotransposons, which account for 17% of the genome, with approximately 100 retaining retrotransposition ability. It binds to L1 promoters, as noted in studies of 189 gastrointestinal cancer patients (95 with stomach, colorectal, or esophageal cancer), highlighting its role in genomic stability (Genetic Eruption and p53 Response). p53 also interacts with epigenetic mechanisms like DNA methylation and histone modifications, and may regulate piRNA factor gene expression, enhancing TE control. For instance, ERV1 family elements are highly enriched at p53 sites, shaping its transcriptional network (Cancers' HLA-G Backdoor).

Aspect

Details

Relevant Numbers/URLs

p53 Binding

Binds L1 promoter to restrict autonomous copies, involved in tumor suppression.

-; p53 Stability and Life or Disorder and

Epigenetic Role

Interacts with DNA methyltransferases, histone modifications for TE control.

-; Genetic Eruption and p53 Response

Cancer Correlation

Frequent mutations in tumors with high L1 load, studied in 189 GI cancer patients (95 specific).

189, 95; Genetic Eruption and p53 Response

piRNA and Transposon Control

piRNA, derived from Alu repeats with over 1 million copies and 0.7% sequence divergence, restrains TEs, preventing gene disruption and inflammation. They are generated via a Dicer-independent pathway, with mitochondrial phospholipid (MitoPLD) facilitating piRNA biogenesis near mitochondria, influencing TE control through energy availability and ROS generation (Electrons Rule Your Biology). Increased ERV levels, a TE subclass, trigger fibro-inflammation, linking to kidney disease development (Cancers' HLA-G Backdoor).

Aspect

Details

Relevant Numbers/URLs

Length and Origin

26-31 nt, derived from Alu repeats, over 1 million copies, 0.7% divergence.

26-31 nt, over 1 million, 0.7%; p53 Stability and Life or Disorder and

Biogenesis

MitoPLD regulates mitochondrial shape, facilitates fusion, generate’s spermatocyte-specific piRNA.

-; Electrons Rule Your Biology

Disease Link

ERV up-regulation triggers fibro-inflammation, linked to kidney disease.

-; Cancers' HLA-G Backdoor


piRNA and NK Cell Function

piRNA is crucial for NK cell immune development, with a 28-base piRNA of the KIR3DL1 gene mediating KIR transcriptional silencing, correlated with CpG methylation in the promoter. This silencing influences NK cell subsets, with over 30,000 subsets identified, and cellular metabolism regulating NK sensitivity based on p53 status (It Has Been Widely Acknowledged That). This links piRNA to immunity via NK cells, especially in tumor microenvironments (TME).


Aspect

Details

Relevant Numbers/URLs

KIR3DL1 piRNA

28-base piRNA mediates KIR transcriptional silencing, correlated with CpG methylation.

28-base; It Has Been Widely Acknowledged That

NK Subsets

Over 30,000 NK cell subsets, metabolism regulates sensitivity based on p53 status.

Over 30,000; It Has Been Widely Acknowledged That

Immune Development

piRNA function with TEs important for NK cell immune development.

-; Cancers' HLA-G Backdoor


p53 and NK Cell Maturation

p53 is coupled to NK cell maturation, with computations from 48 sections of 7 tumor biopsies showing TP53 Consensus Variant (CV) and ncDNA Key Sequence (KS) alterations under KIR B haplotypes, affecting basal cell carcinoma (BCC) risks. RAG expression in uncommitted hematopoietic progenitors and NK precursors marks distinct NK subsets, with innate NK cells unable to express RAGs during ontogeny (p53 Stability and Life or Disorder and).

Aspect

Details

Relevant Numbers/URLs

Tumor Biopsies

TP53 computed from 48 sections of 7 tumor biopsies, alters P53 in BCC under KIR B haplotypes.

48, 7; It Has Been Widely Acknowledged That

RAG Expression

Marks functionally distinct NK subsets, innate NK cells cannot express RAGs.

-; p53 Stability and Life or Disorder and

Maturation Link

p53 linked to NK cell maturation, influencing immune response.

-; It Has Been Widely Acknowledged That


p53 and Immunity

p53 enhances IFN-dependent antiviral activity, increasing IFN release and inducing IFN regulatory factor 9, with L1 retrotransposition inversely correlated with immunologic response genes, including interferons. It regulates MHC class I expression, with peptides at 264-272 (epitope 264scTCR with IL-2) attracting immune surveillance, enhancing NK and T cell activity (Genetic Eruption and p53 Response, p53 Stability and Life or Disorder and).

Aspect

Details

Relevant Numbers/URLs

IFN Signaling

Enhances IFN-dependent antiviral activity, increases IFN release, induces IRF9.

-; Genetic Eruption and p53 Response

MHC Class I

Regulates expression, peptides at 264-272 mediate antitumor effects by NK cells.

264-272; p53 Stability and Life or Disorder and

Immune Correlation

L1 retrotransposition inversely correlated with immunologic response genes.

-; Genetic Eruption and p53 Response


Transposon Control and Immunity

Transposon control impacts immunity through p53 and piRNA effects on NK cells. Increased TE activity, like ERVs, triggers fibro-inflammation, linked to kidney disease, and during viral infections, TE up-regulation near antiviral response genes promotes innate immunity (Cancers' HLA-G Backdoor, Electrons Rule Your Biology). This suggests a feedback loop where TE control influences immune function.

Metabolic and Contextual Insights

An unexpected detail is the metabolic link: mitochondrial fitness, influenced by electron transport chain complexes, affects piRNA biogenesis and function, potentially impacting TE control and NK cell immunity in TMEs. Immune cells require massive energy boosts, with T cell ATP levels doubling in under 30 seconds during stimulation, a process also described for NK cells, highlighting metabolic regulation's role (Electrons Rule Your Biology).

Implications and Future Directions

These relationships suggest that disruptions in transposon control could cascade through p53 and piRNA to affect NK cell function and immunity, with implications for diseases like cancer and viral infections. The metabolic angle adds complexity, suggesting research into mitochondrial-targeted therapies. However, the exact mechanisms, especially in NK cell precursors, require further study, given the complexity and potential for controversy in interpreting these interactions.

Key Citations

Wednesday, February 19, 2025

P53 - Stability and Life Or Disorder and Death!

Chromosomal stability is central to good health, but the push and shove war of genesis, division, transcription, replication and restraint can promote disorder. Disruption can also be retained resulting in ageing, reduced organ function or diseases that often follow. Recently a man escaped his genetic predisposition, to becoming a victim of Alzheimer's disease, illustrating how far we are from understanding even the most well studied conditions. 

Active or passive, mobile Transposable Elements (TE) represent around 40-50% of the human genome and around 30% are found in the non-coding introns of genes. The first intron is conserved as a site of downstream methylation with an inverse relationship to transcription and gene expression. Our understanding of non-coding RNA (ncRNA) suggests one of its primary functions is the restraint of mobile TE's. Several species of ncRNA are associated with this restraint and genomic stability, most contain p53 binding sites that are also known to be involved in tumor suppression. 



Of the short ncRNA species, LINE-1 (L1), siRNAs are typically 21-23 nucleotides long and play a role in silencing L1 transcripts, thus preventing retro-transposition. p53 binds the L1 promoter to restrict autonomous copies of these mobile elements in human cells. Alu elements are the most abundant transposable elements (capable of shifting their positions) containing over one million copies dispersed throughout the human genome. As little as 0.7% sequence divergence resulted in a significant reduction in recombination after double stranded breaks. piRNAs, usually 26-31 nucleotides, derived from Alu repeats restrain transposable elements. Endogenous Retroviruses (ERVs) can give rise to microRNAs (miRNAs) of 22 nucleotides, that can regulate the expression of ERV sequences and other cellular genes.  

TE's serve as templates for the generation of p53- binding-sites on a genome-wide scale . The formation of the p53 binding motifs was facilitated via methylation and deamination that distributes  p53-binding sites and recruits new target genes to its regulatory network in a species-specific manner. This p53 mechanism conducts genomic restraint, where instability and loss or mutation of p53 are commonly associated with hallmark's of cancer. 

Through a novel piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in Natural Killer (NK) cell lineage that may be broadly used in orchestrating immune development. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

The emergence of recombination-activating genes (RAGs) in jawed vertebrates endowed adaptive immune cells with the ability to assemble a diverse set of antigen receptor genes. Innate NK cells are unable to express RAGs or RAG endonuclease activity during ontogeny. However, RAG expression in uncommitted hematopoietic progenitors and NK cell precursors mark functionally distinct subsets of NK cells in the periphery, a surprising and novel role for RAG in the functional specialization of the NK cell lineage. 

The p53 C-terminal including amino acids 360-393 of the full-length protein locate to the mitochondrial permeability transition pore and facilitate apoptosis. However fragments of p53 at amino acid 1-186 and 22-186 drive the most mitochondrial depolarization. Crystal structures demonstrate amino acid 239 binds 106 and 241 binds 105 for one p53 unit and 243 binds 103-264-265 for a second unit, which are both are required to bind BCL-xl for apoptosis.

p53 regulates the expression of major histocompatibility complex (MHC) class I on cell surfaces. p53 peptides presented on HLA/MHC-I could attract immune surveillance as in the target-specific antitumor effects of p53 amino acids at positions 264-272, epitope 264scTCR with IL-2 on p53+/HLA-A2.1+ tumors that are primarily mediated by NK cells.  

Initially, NK cells might be activated due to the combined effect of reduced inhibition (due to decreased KIR3DL1) and increased activation signals from p53 epitopes. This NK cell activation could lead to the release of cytokines that not only enhance further NK activity but also attract and activate T cells. 

To summarize, p53 can influence both the presentation of its antigens through MHC-I and the regulation of NK cell inhibitory receptors like KIR3DL1 via piRNA. This could lead to a more effective immune response against cells with compromised p53 function, although the exact dynamics would depend on the specific context of cancer development, immune cell status, and individual genetic variations.

Tuesday, February 4, 2025

Electrons Rule Your Biology!


The mitochondrial Electron Transport Chain (ETC) is responsible for almost all cellular energy - ATP. One protein, GPD2 was adopted into the inner mitochondrial membrane, perhaps because it enabled ETC production to move to its electron processing limit. To do this, lipids are metabolized when cytoplasmic GPD1-DHAP convert Glycerol Kinase to G3P, which passes two additional electrons from the cytoplasm, through GPD2, to the internalized ETC complexes. 

When Mitochondrial Membrane Potential "Δψm" is within normal range, the GPD2 electrons enhance ATP energy production. When damage to lipids, fatty chains, cholesterols or other elements, constituting the inner mitochondrial membrane, disrupt Δψm the anchored ETC proteins can move fractionally apart causing electrons passing along the chain of ETC complexes to leak.

During disrupted Δψm the additional flow of GPD2 electrons can burden the ETC complexes, resulting in unstable molecules that contain oxygen and are highly reactive known as reactive oxygen species (ROS). Prolific ROS can increase CA+ levels, damage lipids in mitochondrial membranes, which can cause dysfunction and disease. In  a normal cellular environment this process can lead to ferroptosis, an iron-dependent form of cell death, induced by lipid peroxidation. 

A key bidirectional regulator of ferroptosis, p53 can adjust metabolism of iron, lipids, glutathione peroxidase 4, reactive oxygen species, and amino acids via a canonical pathway. GPD2 is transcribed by multiple factors that interact with p53 including Nrf2 and others during stress, but findings with E2F suggest a critical function controls a p53-dependent axis that indirectly regulates E2F-mediated transcriptional repression and cellular proliferation. 

P53 can also induce apoptosis through the mitochondrial pathway, contribute to necrosis by accumulating in the mitochondrial matrix and regulating autophagy. Mitochondrial p53 accumulation is an early event  not merely a consequence of apoptosis or a consequence of binding to damaged organelles in dying cells. Now, emerging evidence shows that ferroptosis plays a crucial role in tumor suppression via p53. 

Immune cells require massive energy boosts during synapse formation and lysis of a target cell when mitochondrial fitness is essential. However, tumor micro environments (TME's) alter lipid metabolism disrupting Δψm causing immune cells to function sub-optimally. Stimulation of T cells triggers a spike in cellular ATP production that doubles intracellular levels in <30 s and causes prolonged ATP release into the extracellular space. ATP release and autocrine feedback, via purinergic receptors collectively contribute to the influx of extracellular Ca2+ that is required for IL-2 production. The process has also been described for Natural Killer (NK) cells.

In the TME innate NK cells are dysfunctional due to lipid peroxidation inhibiting glucose metabolism. If innate immune cells are initially successful, adaptive immune responses may still fail because mitochondria reposition to the immune synapse where they transfer, including to immune cells, which can assist the target to evade immune response. Rapidly proliferating cancer cells may overwhelm initial immune responses and modify immune signaling promoting cancer and vascular remodeling.

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm changes that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis or normal immune signaling and response through mitochondrial biogenesis, differentiation and angiogenesis. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

Mitochondrial Phospholipid (MitoPLD), is anchored to the mitochondrial surface. It regulates mitochondrial shape, facilitating fusion and in the electron-dense nuage, of adjacent mitochondria, performs a critical piRNA generating function that is known to generate a spermatocyte-specific piRNA required for meiosis. piRNA are known to be aberrantly expressed in cancer cells.

Changes in mitochondrial membrane potential and ETC complexes can also influence piRNA-mediated control of transposable elements (TE's) through energy availability, ROS generation, and direct or indirect effects on piRNA biogenesis and function. piRNA restrain TE's that disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV's), a TE subclass, trigger fibro inflammation and play a role in kidney disease development.

In mammals, the transcription of TEs is important for maintaining early embryonic development and related vital aspects of NK cell immune development. Intriguingly, regardless of the cell type, p53 sites are highly enriched in the endogenous retroviral elements of the ERV1 family. This highlights the importance of this repeat family in shaping the transcriptional network of p53 and its transcriptional role in interferon-mediated antiviral immunity





 



 










Tuesday, October 29, 2024

Pathogens And Immunity - Mutual Memories


The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 


Sunday, October 27, 2024

Keep Your TP53 Cool!


Ancestral functions of p53 operate through conserved mechanisms to contain DNA retrotransposons, which are large genomic regions containing repeat sequences. L1 are a class of transposable DNA elements found in 17% of the genome that are evolutionarily associated with primitive viral origins. Around 100 have retained the ability to retro-transpose. Findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility.

HSATII and intact L1 are under selection to maintain CpG motifs, and specific Alu repeat families likewise maintain the proximal presence of inverted repeats to form double-stranded RNA (dsRNA).  This demonstrated that viral mimicry is a general evolutionary mechanism whereby genomes co-opt pathogen-associated features, generated by prone repetitive sequences, likely offering an advantage as a quality control system against transcriptional dysregulation. For multicellular organisms with a high degree of epigenetic regulation, a repeat species with a non-immune function may be co-opted, maintaining stimulatory features that release a danger signal when epigenetic control is lost, such as during the release of repeats after p53 mutations, where immunostimulatory repeats may provide a back-up for p53 functions such as senescence.

Further, torsional flexibility of DNA at certain p53 response elements (RE's) is a significant factor that stages early to late binding of p53 to RE's and has been shown to determine the order and outcome of gene signaling in response to stress and other cellular conditions. This staging prioritizes the initial steps of p53-dependent target-gene expressions, thereby contributing to survival versus death decisions in the p53 system. The mechanism of joint regulation through half-sites is also relevant to transcription and expands the number of genes that may be directly controlled in master regulatory networks.

This was demonstrated through the flexibility of ~200 p53 REs and functional outcomes of p53-target gene activations. Genes belonging to pathways that were activated rapidly upon stress contain p53 REs that have significantly more torsional flexibility relative to p53 REs of genes involved in pathways that are activated later in the response to stress. 

RE binding can also be impacted by way of the following example. A single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor gene (FLT1) generates a half-site p53 response element (RE) that results in p53 responsiveness of the promoter. Transcriptional regulation required an Estrogen Receptor half site response element (ERE) 225 nucleotides upstream.

RE regulation is also evident in the GCGTG core AhR RE invoked by Dioxin. From 48 sequenced samples of two different tumors, Codondex identified 9 unique Key Sequences (KS) of the TP53 Consensus that contained the core AhR 5′-GCGTG-3′ binding sequence, including some that overlapped p53 RE quarter binding sites (underlined) as illustrated below;

(TP53 intron1) GGATAGGAGTTCCAGACCAGCGTGGCCA   TP53 [1706,1710], AhR [1699,1726]

(TP53 intron1) AAAAATTAGCTGGGCGTGGTGGGTGCCT  AhR [1760,1787], TP53 [1783,1787]

Subject to the torsional staging at p53 RE's the implication is that nuclear relocation of AhR, by dioxins, to bind AhR RE's may also influence TP53 transcription especially at overlapping or proximal p53 RE's. p53 binding the TP53 promoter can also invoke an autoregulation that, in addition to torsional flexibility, is also sensitive to dosage and autoregulation at the TP53 P2 internal promoter

Under normal conditions TP53 is infrequently translated and p53 levels remain in steady state, but Under certain epigenetic conditions auto and other forms of  p53 regulation begin to impact its massive regulatory network widely affecting cellular function. p53 can also autoregulate transcription while Tp53 is being transcribed. In these situations TP53 could open to p53 binding because of the active cycle of p53 translation (subject to its degradation and with positive nucleation signals) at particular RE's. 

These conserved mechanisms to restrain retrotransposons and order p53's binding priority at RE's provide insight to the refined nature of gene stability and transcription. However, gene transcription is often imperfect in co-operation or competition with other nearby genes and proteins that affect predicted outcomes. 







Monday, March 4, 2024

p53 Direct Mechanisms In Immunity



Never in the field of molecular oncology have so many sites of posttranslational modification in one protein (p53) been modified by so many different enzymes, but direct response mechanisms that increase immune receptors are rarely discovered and have important implications.  

In the tumor microenvironment (TME), cancer associated fibroblasts (CAFs) display an activated phenotype and can physically remodel the extracellular matrix (ECM). Silencing p53 in the CAFs strongly compromised this activity, implicating p53 as a key contributor to a distinctive CAF feature. Here, the non-autonomous, tumor-suppressive activity of non-mutant p53 cDNA is rewired to become a significant contributor to the CAFs’ tumor-supportive activities. This surprising role for p53 in CAFs suggests that, during tumor progression p53 functionality is altered, not only in the cancer cells, but also in their adjacent stroma.

Although p53 is not mutated in the human placenta, it has become functionally incompetent. Why and how p53 is functionally incompetent in cytotrophoblast cells might well be the key to understanding trophoblast invasion. Vascular remodeling for placentation is controlled by small populations of conventional Natural Killer cells, distinct from much larger populations of uterine NK cells, that acidify the ECM with a2V-ATPase, that activates MMP9, degrades the ECM and releases stored pro-angiogenesis growth factors. Similarly hypoxic TME's that in NK cells sustain excessive mitochondrial fission resulting in fragmentation could cause a2V-ATP activated MMP9 to similarly degrade ECM and promote angiogenesis in the early TME.  

Another MMP protein, MMP2 is a ligand for the Toll-like receptor 2 (Tlr2). Expression of Tlr2 and Tlr4 in the TME is important for the promotion of tumor growth, and when both of these receptors are absent, growth is compromised. Furthermore, the expression of Tlr2 and Tlr4 in both hematopoietic and stromal compartments appears to support MMP2-driven tumor growth.

The integration of the TLR gene family into the p53 regulatory network is unique to primates. p53 promoter response elements that are targeted by this DNA damage and stress-responsive regulator suggest a general p53 role in the control of human TLR gene expression. TLR genes show responses to DNA damage, and most are p53-mediated. TLR's mediate innate immunity to a wide variety of threats through recognition of conserved pathogen-associated molecular motifs. Expression of all TLR genes, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors with considerable inter-individual variability. Most TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites.

A polymorphism in a TLR8 response element provided the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings—demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress—have many implications for health and disease, as well as for understanding the evolution of DNA damage and p53 responsive networks. That p53 can directly increase an inflammatory response differs from the generally held view relating to the antagonistic affect of p53 on inflammation directed by NF-κB. However, the direct mechanism here is different in that it involves another p53-mediated increase in a receptor that translates ligand interactions into cytokine responses.