P53 - Stability and Life Or Disorder and Death!

There is something ancient about the struggle between order and disorder in biology. A cell does not merely live by dividing, signaling, and repairing itself. It lives by maintaining interpretability. Its genome must remain legible enough to be copied, restrained enough not to erupt into instability, and coherent enough that surrounding systems — especially the immune system — can still distinguish function from failure. In that sense, p53 is not simply a tumor suppressor in the narrow modern meaning of the phrase. It is closer to a molecular governor of biological intelligibility, one of the factors that helps determine whether stress remains containable or tips into forms of disorder.

The broader role has appeared repeatedly across Codondex discussions, from Expanding Treatment Horizons to Does SARS-CoV2 Strangle P53 to kill Natural Killer Immunity?, where p53 was already being read less as an isolated tumor suppressor and more as part of a wider immune and genomic control system.

That older and deeper role becomes clearer once p53 is viewed not only through apoptosis or cell-cycle arrest, but through its relationship with the repetitive genome. Work over the last decade has shown that p53 does not merely respond to genetic insult after the fact. It can directly repress human LINE1 retrotransposons by binding the 5′UTR and promoting local repressive chromatin, and more recent work has extended that picture by showing p53-dependent restraint of LINE1-associated RNA-DNA hybrid states as well. One of the great guardians of cellular integrity is therefore also engaged in policing one of the genome’s recurrent internal threats: mobile and semi-mobile repetitive sequence that, when released from restraint, can destabilize chromosomal order and provoke inflammatory consequences. p53 directly represses human LINE1 transposons and p53-mediated regulation of LINE1 retrotransposon-derived R-loops both push that picture into sharper focus.

But the relationship runs in both directions. Transposable elements are not only targets of p53; they have also helped shape the p53 regulatory landscape itself. A substantial body of work has shown that human retrotransposons contain p53 responsive elements, meaning that the repetitive genome has donated part of the sequence architecture through which p53 now reads and regulates stress. This is one of those places where the older division between “functional genome” and “junk” becomes difficult to maintain. Repetitive sequence has not only threatened order. It has also contributed to the grammar by which order is defended.

Once that is appreciated, the immune side of the problem begins to look less like a separate field and more like a continuation of the same one. If p53 helps determine whether genomic instability remains suppressed, then it also helps determine whether such instability becomes visible to immune surveillance. Emerging views now frame p53 as a major regulator of NK-cell tumor immunosurveillance, not because NK cells are somehow subordinate to p53, but because p53 influences so many of the target-cell properties that NK cells are built to read: stress ligands, metabolic distress, microenvironmental signals, and the broader state of cellular legitimacy.

One of the clearest examples is the p53-dependent induction of ligands visible to NK activation pathways. When wild-type p53 is induced in tumor cells, NK cells can be alerted through upregulation of the NKG2D ligands ULBP1 and ULBP2. That is an important bridge. It means p53 is not only preserving internal order; it can also help convert intracellular stress into a surface-readable signal that tells NK cells something has gone wrong. The target is no longer merely unstable. It becomes interpretable to innate immune surveillance.

A parallel bridge exists through antigen processing. p53 has also been shown to increase MHC class I expression by upregulating ERAP1, a trimming enzyme involved in preparing peptides for class I presentation. That does not collapse NK and T-cell biology into one another, but it does reinforce the larger point: p53 influences whether a distressed cell remains hidden, partially legible, or fully exposed to immune scrutiny. It affects not just whether the cell survives, but how clearly that cell can be judged by the systems around it.

The recombination thread can also be preserved, though it needs to be understood in the right register. Mature NK cells do not generate their recognition receptors through classical V(D)J recombination in the way T and B cells do. Their receptors are fundamentally germline encoded. Yet that is not the end of the recombination story. Work on NK ontogeny has shown that a history of RAG expression in progenitors and NK precursors marks functionally distinct NK subsets later in the periphery, with consequences for fitness, survival, and responsiveness. Recombination machinery therefore leaves a developmental trace on NK biology, even if it does not build the mature receptor repertoire in the adaptive sense.

That developmental nuance matters because it prevents the argument from becoming either too weak or too strong. Too weak, and the relationship between recombination-linked stress and NK function disappears. Too strong, and NK cells are mistakenly described as if they were just another rearranging lymphocyte lineage. The better reading is that recombination biology, DNA damage response history, and developmental programming can shape the later functional competence of NK cells without making their mature surveillance logic identical to that of T cells.

A similar caution, and opportunity, appears in the KIR story. One of the most interesting findings in NK regulation is that KIR expression can be governed by bidirectional promoter logic and antisense transcription. In particular, KIR antisense transcripts processed into a 28-base PIWI-like small RNA have been linked to transcriptional silencing, while related work on KIR antisense lncRNAs and probabilistic promoter switching suggests that inhibitory receptor expression is shaped by a layered interaction between transcription, antisense regulation, and epigenetic commitment. This does not establish a direct p53→piRNA→KIR3DL1 pathway. But it does show that the NK lineage is not insulated from the wider world of small RNA restraint and genome-governed silencing.

That is where the Codondex theme begins to re-emerge. If p53 sits in one part of the cell as a governor of repetitive-element restraint, and if NK inhibitory receptor choice is itself touched by small-RNA and antisense-mediated silencing logic, then the two systems may not be identical, but they may still rhyme. Both are concerned with the management of unstable potential. Both are concerned with whether latent disorder is allowed to become active. Both are concerned with which signals are permitted to surface and which are held in reserve. This is not yet a single proven pathway. It is a systems-level parallel supported by a growing amount of molecular detail.

There is another reason the p53–NK connection deserves attention. In some settings, p53 activation appears able to convert repetitive-element biology into something resembling a warning flare. Pharmacologic activation of p53 has been linked to antiviral-like and immune-stimulatory states, and the broader literature now places p53 within a network that can enhance NK recognition and tumor destruction through multiple channels rather than one single canonical mechanism. The significance of that shift should not be underestimated. It means p53 is no longer best understood only as the decider of cell fate from within. It is also a participant in the communication of cellular fate to the outside world.

So the central question remains a fruitful one. Is p53 merely a brake on instability, or is it also part of the language by which instability becomes visible to elimination? The literature increasingly favors the second possibility. p53 restrains transposable elements. p53 shapes stress-ligand display. p53 influences antigen processing and MHC-I expression. p53 intersects with developmental and regulatory processes that matter to NK-cell competence and target recognition. The picture that emerges is not of a single linear circuit, but of a pressure point where genome integrity, immune legibility, and cellular fate begin to converge.

In that light, p53 can still be read as this article’s central character without overstatement. When p53 function is preserved, a cell under strain is more likely to remain ordered, to arrest, to die cleanly, or to become visible enough for immune removal. When p53 function is lost, not only does instability grow, but the cell’s interpretability may degrade with it. Disorder then becomes doubly dangerous: more abundant internally, and more ambiguous externally. That may be one of the deeper meanings of p53 in cancer and perhaps in biology more generally. It is not only a guardian against mutation. It is one of the means by which life keeps disorder readable.

Electrons Rule Your Biology!

The mitochondrial Electron Transport Chain (ETC) is responsible for almost all cellular energy - ATP. One protein, GPD2 was adopted into the inner mitochondrial membrane, perhaps because it enabled ETC production to move to its electron processing limit. To do this, lipids are metabolized when cytoplasmic GPD1-DHAP convert Glycerol Kinase to G3P, which passes two additional electrons from the cytoplasm, through GPD2, to the internalized ETC complexes. 

When Mitochondrial Membrane Potential "Δψm" is within normal range, the GPD2 electrons enhance ATP energy production. When damage to lipids, fatty chains, cholesterols or other elements, constituting the inner mitochondrial membrane, disrupt Δψm the anchored ETC proteins can move fractionally apart causing electrons passing along the chain of ETC complexes to leak.

During disrupted Δψm the additional flow of GPD2 electrons can burden the ETC complexes, resulting in unstable molecules that contain oxygen and are highly reactive known as reactive oxygen species (ROS). Prolific ROS can increase CA+ levels, damage lipids in mitochondrial membranes, which can cause dysfunction and disease. In  a normal cellular environment this process can lead to ferroptosis, an iron-dependent form of cell death, induced by lipid peroxidation. 

A key bidirectional regulator of ferroptosis, p53 can adjust metabolism of iron, lipids, glutathione peroxidase 4, reactive oxygen species, and amino acids via a canonical pathway. GPD2 is transcribed by multiple factors that interact with p53 including Nrf2 and others during stress, but findings with E2F suggest a critical function controls a p53-dependent axis that indirectly regulates E2F-mediated transcriptional repression and cellular proliferation. 

P53 can also induce apoptosis through the mitochondrial pathway, contribute to necrosis by accumulating in the mitochondrial matrix and regulating autophagy. Mitochondrial p53 accumulation is an early event  not merely a consequence of apoptosis or a consequence of binding to damaged organelles in dying cells. Now, emerging evidence shows that ferroptosis plays a crucial role in tumor suppression via p53. 

Immune cells require massive energy boosts during synapse formation and lysis of a target cell when mitochondrial fitness is essential. However, tumor micro environments (TME's) alter lipid metabolism disrupting Δψm causing immune cells to function sub-optimally. Stimulation of T cells triggers a spike in cellular ATP production that doubles intracellular levels in <30 s and causes prolonged ATP release into the extracellular space. ATP release and autocrine feedback, via purinergic receptors collectively contribute to the influx of extracellular Ca2+ that is required for IL-2 production. The process has also been described for Natural Killer (NK) cells.

In the TME innate NK cells are dysfunctional due to lipid peroxidation inhibiting glucose metabolism. If innate immune cells are initially successful, adaptive immune responses may still fail because mitochondria reposition to the immune synapse where they transfer, including to immune cells, which can assist the target to evade immune response. Rapidly proliferating cancer cells may overwhelm initial immune responses and modify immune signaling promoting cancer and vascular remodeling.

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm changes that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis or normal immune signaling and response through mitochondrial biogenesis, differentiation and angiogenesis. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

Mitochondrial Phospholipid (MitoPLD), is anchored to the mitochondrial surface. It regulates mitochondrial shape, facilitating fusion and in the electron-dense nuage, of adjacent mitochondria, performs a critical piRNA generating function that is known to generate a spermatocyte-specific piRNA required for meiosis. piRNA are known to be aberrantly expressed in cancer cells.

Changes in mitochondrial membrane potential and ETC complexes can also influence piRNA-mediated control of transposable elements (TE's) through energy availability, ROS generation, and direct or indirect effects on piRNA biogenesis and function. piRNA restrain TE's that disrupt genes, chromosomal stability, damage DNA, cause inflammation, disease and/or cell death. For example, increased levels of endogenous retroviruses (ERV's), a TE subclass, trigger fibro inflammation and play a role in kidney disease development.

In mammals, the transcription of TEs is important for maintaining early embryonic development and related vital aspects of NK cell immune development. Intriguingly, regardless of the cell type, p53 sites are highly enriched in the endogenous retroviral elements of the ERV1 family. This highlights the importance of this repeat family in shaping the transcriptional network of p53 and its transcriptional role in interferon-mediated antiviral immunity. 

 

 

Pathogens And Immunity - Mutual Memories

The aryl hydrocarbon receptor (AhR) is a regulator of Natural Killer (NK) cell activity in vivo and is increasingly recognized for its role in the differentiation and activity of immune cell subsets. AhR ligands found in the diet, can modulate the antitumor effector functions. In vivo administration of toxin FICZ, an AhR ligand, enhances NK cell control of tumors in an NK cell and AhR-dependent manner. Similar effects on NK cell potency occur with AhR dietary ligands, potentially explaining the numerous associations that have been observed in the past between diet and NK cell function. 

Dioxins bind AhR and translocate to the nucleus where they influence DNA transcription. The dioxin response element (DRE) is a DNA binding site for AhR that occurs widely through the genome. Activation of p53 by DNA damaging agents differentially regulates AhR levels. More than 40 samples, biopsied from 4 tumors, resolved in Codondex repetitive sequences of TP53. The highest ranking short Key Sequences (p53KS) were identified using specificity for repeats and were heavily clustered at two intron locations. Each were found to include DRE, palindromes and p53 quarter or half binding sites. 

Many palindromes in the genome are known as fragile sites, prone to chromosome breakage which can lead to various genetic rearrangements or cell death. The ability of certain palindromes to initiate genetic recombination lies in their ability to form secondary structures in DNA which can cause replication stalling and double-strand breaks. Given their recombinogenic nature, it is not surprising that palindromes in the human genome are involved in genetic rearrangements in cancer cells as well as other known recurrent translocations and deletions associated with certain syndromes in humans.

In severe combined immune deficiency (scid) survival of lymphocyte precursors, harboring broken V(D)J coding ends, is prolonged by p53 deficiency which allows for the accumulation of aneuploid cells. This demonstrated that a p53-mediated DNA damage checkpoint contributes to the immune deficiency characteristic of the scid mutation and limits the oncogenic potential of DSBs generated during V(D)J recombination.

Repetitive DNA sequences, including palindromes can transpose locations under certain conditions. These are thought to have evolved from pathogenic remnants, deposited as DNA in genes, that can be transcribed and folded, often at nucleotide repeats, to form double stranded DNA or RNA. TP53 is the most mutated gene in cancer. Many of its binding sites have evolved through recombination events and are predominantly located among repeats. Therefore, binding sites and mutation frequency may mutually pressure repetitive sequences, DNA breaks and responses to potentially conserve immune memory, for lymphocyte and NK cell precursors, but to also provide a DNA record of pathogen candidates, 

Keep Your TP53 Cool!

Ancestral functions of p53 operate through conserved mechanisms to contain DNA retrotransposons, which are large genomic regions containing repeat sequences. L1 are a class of transposable DNA elements found in 17% of the genome that are evolutionarily associated with primitive viral origins. Around 100 have retained the ability to retro-transpose. Findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility.

HSATII and intact L1 are under selection to maintain CpG motifs, and specific Alu repeat families likewise maintain the proximal presence of inverted repeats to form double-stranded RNA (dsRNA).  This demonstrated that viral mimicry is a general evolutionary mechanism whereby genomes co-opt pathogen-associated features, generated by prone repetitive sequences, likely offering an advantage as a quality control system against transcriptional dysregulation. For multicellular organisms with a high degree of epigenetic regulation, a repeat species with a non-immune function may be co-opted, maintaining stimulatory features that release a danger signal when epigenetic control is lost, such as during the release of repeats after p53 mutations, where immunostimulatory repeats may provide a back-up for p53 functions such as senescence.

Further, torsional flexibility of DNA at certain p53 response elements (RE's) is a significant factor that stages early to late binding of p53 to RE's and has been shown to determine the order and outcome of gene signaling in response to stress and other cellular conditions. This staging prioritizes the initial steps of p53-dependent target-gene expressions, thereby contributing to survival versus death decisions in the p53 system. The mechanism of joint regulation through half-sites is also relevant to transcription and expands the number of genes that may be directly controlled in master regulatory networks.

This was demonstrated through the flexibility of ~200 p53 REs and functional outcomes of p53-target gene activations. Genes belonging to pathways that were activated rapidly upon stress contain p53 REs that have significantly more torsional flexibility relative to p53 REs of genes involved in pathways that are activated later in the response to stress. 

RE binding can also be impacted by way of the following example. A single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor gene (FLT1) generates a half-site p53 response element (RE) that results in p53 responsiveness of the promoter. Transcriptional regulation required an Estrogen Receptor half site response element (ERE) 225 nucleotides upstream.

RE regulation is also evident in the GCGTG core AhR RE invoked by Dioxin. From 48 sequenced samples of two different tumors, Codondex identified 9 unique Key Sequences (KS) of the TP53 Consensus that contained the core AhR 5′-GCGTG-3′ binding sequence, including some that overlapped p53 RE quarter binding sites (underlined) as illustrated below;

(TP53 intron1) GGATAGGAGTTCCAGACCAGCGTGGCCA   TP53 [1706,1710], AhR [1699,1726]

(TP53 intron1) AAAAATTAGCTGGGCGTGGTGGGTGCCT  AhR [1760,1787], TP53 [1783,1787]

Subject to the torsional staging at p53 RE's the implication is that nuclear relocation of AhR, by dioxins, to bind AhR RE's may also influence TP53 transcription especially at overlapping or proximal p53 RE's. p53 binding the TP53 promoter can also invoke an autoregulation that, in addition to torsional flexibility, is also sensitive to dosage and autoregulation at the TP53 P2 internal promoter. 

Under normal conditions TP53 is infrequently translated and p53 levels remain in steady state, but Under certain epigenetic conditions auto and other forms of  p53 regulation begin to impact its massive regulatory network widely affecting cellular function. p53 can also autoregulate transcription while Tp53 is being transcribed. In these situations TP53 could open to p53 binding because of the active cycle of p53 translation (subject to its degradation and with positive nucleation signals) at particular RE's. 

These conserved mechanisms to restrain retrotransposons and order p53's binding priority at RE's provide insight to the refined nature of gene stability and transcription. However, gene transcription is often imperfect in co-operation or competition with other nearby genes and proteins that affect predicted outcomes. 

p53 Direct Mechanisms In Immunity

Never in the field of molecular oncology have so many sites of posttranslational modification in one protein (p53) been modified by so many different enzymes, but direct response mechanisms that increase immune receptors are rarely discovered and have important implications.  

In the tumor microenvironment (TME), cancer associated fibroblasts (CAFs) display an activated phenotype and can physically remodel the extracellular matrix (ECM). Silencing p53 in the CAFs strongly compromised this activity, implicating p53 as a key contributor to a distinctive CAF feature. Here, the non-autonomous, tumor-suppressive activity of non-mutant p53 cDNA is rewired to become a significant contributor to the CAFs’ tumor-supportive activities. This surprising role for p53 in CAFs suggests that, during tumor progression p53 functionality is altered, not only in the cancer cells, but also in their adjacent stroma.

Although p53 is not mutated in the human placenta, it has become functionally incompetent. Why and how p53 is functionally incompetent in cytotrophoblast cells might well be the key to understanding trophoblast invasion. Vascular remodeling for placentation is controlled by small populations of conventional Natural Killer cells, distinct from much larger populations of uterine NK cells, that acidify the ECM with a2V-ATPase, that activates MMP9, degrades the ECM and releases stored pro-angiogenesis growth factors. Similarly hypoxic TME's that in NK cells sustain excessive mitochondrial fission resulting in fragmentation could cause a2V-ATP activated MMP9 to similarly degrade ECM and promote angiogenesis in the early TME.  

Another MMP protein, MMP2 is a ligand for the Toll-like receptor 2 (Tlr2). Expression of Tlr2 and Tlr4 in the TME is important for the promotion of tumor growth, and when both of these receptors are absent, growth is compromised. Furthermore, the expression of Tlr2 and Tlr4 in both hematopoietic and stromal compartments appears to support MMP2-driven tumor growth.

The integration of the TLR gene family into the p53 regulatory network is unique to primates. p53 promoter response elements that are targeted by this DNA damage and stress-responsive regulator suggest a general p53 role in the control of human TLR gene expression. TLR genes show responses to DNA damage, and most are p53-mediated. TLR's mediate innate immunity to a wide variety of threats through recognition of conserved pathogen-associated molecular motifs. Expression of all TLR genes, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors with considerable inter-individual variability. Most TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites.

A polymorphism in a TLR8 response element provided the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings—demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress—have many implications for health and disease, as well as for understanding the evolution of DNA damage and p53 responsive networks. That p53 can directly increase an inflammatory response differs from the generally held view relating to the antagonistic affect of p53 on inflammation directed by NF-κB. However, the direct mechanism here is different in that it involves another p53-mediated increase in a receptor that translates ligand interactions into cytokine responses.

p53 Convergence and Immunity

Renewed interest in Bradykinin and its inactivation, by Angiotensin Converting Enzyme (ACE), during Covid infection reconfirmed RAS and KKS (Kallikrein-Kinin, Bradykinin) as the major systems of vasodilation and constriction contributing to blood pressure and disease. ACE2, a molecule of focus in Covid, reduces the Bradykinin product des-Arg9 bradykinin to inactive metabolites.

In pre-eclampsia reduced Kallikrein (KLK) generation and Bradykinin's activation, via its BK1 and BK2 receptor, modulates stress response through NF-κB and p53 pathways. These are the major cellular stress response pathways that promote or oppose apoptosis and influence cell fate. Two functionally divergent p53-responsive elements were discovered in the rat BK2 receptor promoter, which interact with ACE, play a significant role regulating vascular tone and blood pressure and in the cross-talk between RAS and KKS. 

In uterine immune cells RAS proteins AT1, AT2, and ANP are expressed and ANP co-localizes to uterine Natural Killer (uNK) cells between pregnancy day 10 and 12, immediately before spiral arterial modification. In mice this suggested that uNK contributes to the physiological changes in blood pressure between days 5 and 12.

During the first trimester the uNK cells dramatically increase, from around 15% to 70% of immune cells in the Decidua of the Uterus. Expressed RAS-KKS proteins during this time may be solely responsible for amplified stimulation of the plasma contact system at least via p53-mediated transcription and activation of the BK2 promoter.

In myocytes stretch-mediated release of angiotensin II (AngII) induced apoptosis by activating p53 that enhanced local RAS and decreased the Bcl-2-to-Bax protein ratio in the cell. In endothelial cells mechanical stretch interconnected innate and adaptive immune response in hypertension. This suggests that mechanical forces, such as those experienced in hypertension, can influence the immune system and contribute to inflammation, vascular damage associated with high blood pressure and vascular remodeling.

MYADAM and PRPF31 were the only genes from a meta-analysis that linked diastolic, systolic blood pressure and hypertension. These are located on Chromosome 19 between 50-55,000,000 bps, which includes all Killer immunoglobulin like receptors (KIR's), Kallikrein related peptidases (KLK's) and c19MC MiRNA's, in a region characterized by a 2X background deletion rate. During different trimesters it was found that NK cells, in pre-eclampsia, directly incorporate c19MC MiRNA's that are important to placental development and their deregulation could lead to the development of pre-eclampsia. 

It adds up that the massively disproportionate uNK activity in pregnancy and its impact on the mechanics of blood pressure could amplify sensitivities for p53 mediated stress response. It’s known that uNK cells contribute to the remodeling of spiral arteries and regulation of blood pressure, which are critical for fetal development. Similarly, on a cellular scale, abnormal cell growth and expansion of NK cells, may also amplify conditions that direct NK education and licensing to support growth, as in solid tumors and micro-vascular remodeling, or trigger inflammation, through cytokine expression and/or granulocyte killing of expanded missing-self cells. 

All Roads Lead to (Ch)Romosome 19!

A hepatocellular carcinoma (HCC) co-regulatory network exists between chromosome 19 microRNA cluster (C19MC) at 19q13.42, melanoma-A antigens, IFN-γ and p53, promoting an oncogenic role of C19MC that is disrupted by metal ions zinc and nickel. IFN-γ plays a co-operative role whereas IL-6 is antagonistic, each have a major bearing on the expression of HLA molecules on cancer cells. Analysis of Mesenchymal stem cells and cancer cells predicted C19MC modulation of apoptosis in induced pluripotency and tumorigenesis.

Key, differentially expressed genes in HCC included cancer-related transcription factors (TF) EGR1, FOS, and FOSB. From mRNA and miRNA expression profiles these were most enriched in the p53 signaling pathway where mRNA levels of each decreased in HCC tissues. In addition, mRNA levels of CCNB1, CCNB2, and CHEK1, key markers of the p53 signaling pathway, were all increased. miR-181a-5p regulated FOS and EGR1 to promote the invasion and progression of HCC by p53 signaling pathway and it plays an important role in maturation or impairment of natural killer (NK) cells.

A pan-cancer analysis, on microRNA-associated gene activation, produced the top 57 miRNAs that positively correlated with at least 100 genes. miR-150, at 19q13.33 was the most active, it positively correlated with 1009 different genes each covering at least 10 cancers. It is an important hematopoietic, especially B, T, and NK, cell specific miRNA.

Rapid functional impairment of NK cells following tumor entry limits anti-tumor immunity. Gene regulatory network analysis revealed downregulation of TF regulons, over pseudo-time, as NK cells transition to their impaired end state. These included AP-1 complex TF's, Fos, Fosb (19q13.32), Jun, Junb (19p13.13), which are activated during NK cell cytolytic programs and down regulated by interactions with inhibitory ligands. Other down-regulated TF's included Irf8, Klf2 (19p13.11), Myc, which support NK cell activation and proliferation. There were no significantly upregulated TF's suggesting that the tumor-retained NK state arises from the reduced activity of core transcription factors associated with promoting mature NK cell development and expansion.

Innate immune, intra-tumoral, stimulatory dendritic cells (SDCs) and NK cells cluster together and are necessary for enhanced T cell tumor responses. In human melanoma, SDC abundance is associated with intra-tumoral expression of the cytokine producing gene FLT3LG (19q13.33) that is predominantly produced by NK cells in tumors. Computed tomography exposes patients to ionizing X-irradiation. Determined trends in the expression of 24 radiation-responsive genes linked to cancer, in vivo, found that TP53 and FLT3LG expression increased linearly with CT dose. 

Undifferentiated embryonal sarcoma of the liver displays high aneuploidy with recurrent alterations of 19q13.4 that are uniformly associated with aberrantly high levels of transcriptional activity of C19MC microRNA. Further, TP53 mutation or loss was present with all samples that also display C19MC changes. The 19q13.4 locus is gene-poor with highly repetitive sequences. Given the noncoding nature and lack of an obvious oncogene, disruption of the nearby C19MC regulatory region became a target for tumorigenesis. 

The endogenous retroviral, hot-spot deletion rate at 19p13.11-19p13.12 and 19q33-19q42 occurs at double the background deletion rate. Clustered in and around these regions are many gene families including KIR, Siglec, Leukocyte immunoglobulin-like receptors and cytokines that associate important NK gene features to proximal NK genes that were overrepresented in a meta analysis of blood pressure. 

Endogenous retroviruses that invite p53 and its transcriptional network, at retroviral hot-spots, suggest that lymphocyte progenitors, such as ILC's and expanded, NK cells are synergistically responsive to transcription from this busy region including by the top differentially expressed blood pressure genes MYADM, GZMB, CD97, NKG7, CLC, PPP1R13L , GRAMD1A as well as (RAS-KKS) Kallikrein related peptidases to educate early and expanded NK cells that shape immune responses.