Indispensable Mitochondria - Cancers back door?

Immediately prior to fertilization spermatozoa are devoid of Mitochondrial DNA (mtDNA), potentially explaining an aspect about selection that may serve the legacy for maternal immune tolerance. Post fertilization, on day 11-13, outermost trophoblasts of the blastocyst dock with the decidual lining as it embeds in the uterine wall. Then, maternal vascular remodeling and placental formation begin toward successful implantation. 

Higher quality trophoblasts are associated with lower mtDNA content. Moreover, euploid blastocysts with higher mtDNA content had a lower chance to implant and mtDNA replication is strictly downregulated between fertilization and the implantation. What is it about absent or reduced mtDNA that may also relate to the mechanics of immune tolerance and vascular remodeling, which are also features of solid tumors.

The initial absence or downregulation of MtDNA, may relate an immune tolerance by uterine Natural Killer (NK) cells. As mtDNA upregulates, after day 12, it may initiate NK auto-reactivity required for maternal microvascular remodeling. This auto-immune paradox is a prerequisite for vascular remodeling, which is also seen in localized hypertension, and the likely basis of successful blastocyst implantation. Acutely, micro-hypertension induced mechanical stretch, on endothelial cells, interconnects innate and adaptive immune responses. 

The dominant cell in the decidua is an NK subset (dNK), they express low levels of IFN-γ and express proteins of Renin Angiotensin System (RAS). At day 12 RAS peptide ANP colocalizes to dNK’s suggesting that dNK RAS infers localized responsiveness.  When TFAM, required for transcription of mtDNA, was deleted from cardiomyocytes, after 32 days, animals developed cardiomyopathy and Nppa (gene encoding ANP) and Nppb expression was elevated. 

In monocytes increased endothelial stretch activates STAT3, which is involved in driving almost all pathways that control NK cytolytic activity and reciprocal regulatory interactions between NK cells and other components of the immune system. The crosstalk between STAT3 and p53/RAS signaling controls cancer cell metastasis. p53, Stat3, and, potentially, the estrogen receptor are thought to act as co-regulators, affecting mitochondrial gene expression through protein-protein interactions. Co-immunoprecipitation of p53 with TFAM suggests it may regulate mitochondrial DNA-damage repair.

Like initial trophoblasts with low level mtDNA, mature cells, like cardiomyocytes that prolong low level mtDNA may also aggravate autoimmune sponsored hypertension that remodels microvascular networks providing nutrients for growth of reduced mtDNA stem cell replicas. Indeed, mitochondrial dysfunction (from depleted mtDNA) does not affect pluripotent gene expression, but results in severe defects in lineage differentiation.

During severe sepsis, intense, on-going mtDNA damage and mitochondrial dysfunction could overwhelm the capacity for mitochondrial biogenesis, leading to a gradual decline in mtDNA levels over time. This may contribute to monocyte immune deactivation, which is associated with adverse clinical outcomes and could be reversed by IFN-γ. 

Identifying cells that optimally educate cocultured NK cells for precision IFN-γ and cytolytic responsiveness is part of the ongoing work by the Codondex team.

Can Ancient Pathways Defeat Cancer?

It has been widely acknowledged that non-coding RNAs are master-regulators of genomic function. The association between human introns and ncRNAs has a pronounced synergistic effect with important implications for fine-tuning gene expression patterns across the entire genome. There is also strong preference of ncRNA from intronic regions particularly associated with the transcribed strand. 

Accumulating evidence demonstrates that, analogous to other small ncRNAs (e.g. miRNAs, siRNA's etc.) piRNAs have both oncogenic and tumor suppressive roles in cancer development. Functionally, piRNAs maintain genomic integrity and cell age by silencing repetitive, transposable elements, and are capable of regulating the expression of specific downstream target genes in a post-transcriptional manner. 

Unlike miRNAs and siRNAs, the precursors of piRNAs are single stranded transcripts without any prominent secondary hairpin structures. These precursors are usually generated from specific genomic locations containing repetitive elements, a process that is typically orchestrated via a Dicer-independent pathway. 

Without restraint, the ancient, L1 class of transposable elements can interrupt the genome through insertions, deletions, rearrangements, and copy number variations. L1 activity has contributed to instability and evolution of genomes, and is tightly regulated by DNA methylation, histone modifications, and piRNA. They can impact genome variation by mispairing and unequal crossing-over during meiosis due to repetitive DNA sequences. Indeed meiotic double-strand breaks are the proximal trigger for retrotransposon eruptions as highlighted in animals lacking p53.

Through a novel 28-base small piRNA of the KIR3DL1 gene, antisense transcripts mediate Killer Ig-like receptor (KIR) transcriptional silencing in immune somatic, Natural Killer (NK) cell lineage, a mechanism that may be broadly used in orchestrating immune development. Expressed on NK cells, KIR's are important determinants of NK cell function. Silencing  individual KIR genes is strongly correlated with the presence of CpG dinucleotide methylation within the promoter. 

Structural research exposed the enormous binding complexity behind KIR haplotypes and HLA allotypes. Not only via protein structures, but also plasticity and selective binding behavior's as influenced by extrinsic factors. One study links a specific recognition of HLA-C*05:01 by KIR2DS4 receptor through a peptide highly conserved among bacteria pathogenic in humans. Another demonstrated a hierarchy of functional peptide selectivity by KIR–HLA-C interactions, including cross-reactive binding, with relevance to NK cell biology and human disease associations. Additionally a p53 peptide most overlapped other high performance peptides for a HLA-C allotype C*02:02 that shares identical contact residues with C*05:01.

Ancient pathways linking p53 to attenuation of aberrant stem cell proliferation may predate the divergence between vertebrates and invertebrates. Human stem cell proliferation, as determined by p53 transposable element silencing, may also serve a NK progenitor to promote the repertoire of more than 30,000 NK cell subsets. 

A recent study showed that wild type p53 can restrain transposon mobility through interaction with PIWI-piRNA complex. Also, cellular metabolism regulates sensitivity to NK cells depending on P53 status and P53 pathway is coupled to NK cell maturation leaving open the possibility that a direct relationship exists. Further, functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and KIR B haplotypes provide selective pressure for altered P53 in BCC tumors. 

Anticipating p53's broader influences or responses, cells, extracted from 48 different sections of 7 tumor biopsies were sequenced and TP53 DNA computed using Codondex algorithm. Each section produced a TP53 Consensus Variant (CV), represented by its intron1, ncDNA Key Sequence's (KS). Bioinformatic correlations between each KS and cytotoxicity resulting from NK coculture with the section may predict KIR-HLA and extrinsic factor plasticity to reliably determine from KS's, optimal cell/tissue selections for NK cell education and licensing. 

Immune Synchronization

Stem Cell

Navigating the regulatory regimes that govern drug safety can be challenging. But, rigorous standards are more relaxed in the lesser used track for autologous and/or minimally manipulated cell treatments. Toward meeting the challenges of this minimal regulation track, the wide-spectrum of NK cells, of the innate immune system, are compelling candidates to address complex cellular and tissue personalization's or conditions of disease. One effect of cell function on NK cell potency occurs via aryl hydrocarbon receptor (AhR) dietary ligands, potentially explaining numerous associations that have been observed in the past.

The AhR was first identified to bind the xenobiotic compound dioxin, environmental contaminants and toxins in addition to a variety of natural exogenous (e.g., dietary) or endogenous ligands and expression of AhR is also induced by cytokine stimulation. Activation with an endogenous tryptophan derivative, potentiates NK cell IFN-γ production and cytolytic activity which, in vivo, enhances NK cell control of tumors in an NK cell and AhR-dependent manner.

A combination of ex vivo and in vivo studies revealed that Acute Myeloid Leukemia (AML) skewed Innate Lymphoid Cell (ILC) Progenitor towards ILC1's and away from NK cells as a major mechanism of ILC1 generation. This process was driven by AML-mediated activation of AhR, a key transcription factor in ILC's, as inhibition of AhR led to decreased numbers of ILC1's and increased NK cells in the presence of AML.

Activation of AhR also induces chemoresistance and facilitates the growth, maintenance, and production of long-lived secondary mammospheres, from primary progenitor cells. AhR supports the proliferation, invasion, metastasis, and survival of the Cancer Stem Cells (CSC's) in choriocarcinoma, hepatocellular carcinoma, oral squamous carcinoma, and breast cancers leading to therapy failure and tumor recurrence.

Loss of AhR increases tumorigenesis in p53-deficient mice and activation of p53 in human and murine cells, by DNA-damaging agents, differentially regulates AhR levels. Activation of the AhR/CYP1A1 pathway induces epigenetic repression of many tumor suppressor and tumor activating genes, through modulation of their DNA methylation, histone acetylation/deacetylation, and the expression of several miRNAs. 

p53 is barely detectable under normal conditions, but levels begin to elevate and locations change particularly in cells undergoing DNA damage. The significant network effect of p53 availability and its mutational status in cancer makes it the worlds most widely studied gene. 

From 48 sequenced samples of two different tumors, Codondex identified 316 unique Key Sequences (KS) of the TP53 Consensus. 9 of these contained the core AhR 5′-GCGTG-3′ binding sequence, and some overlapped p53 quarter binding sites as illustrated below;

Key Sequence                                                                           

GGATAGGAGTTCCAGACCAGCGTGGCCA (intron1) AhR [1699,1726], p53 @ [1706,1710]

AAAAATTAGCTGGGCGTGGTGGGTGCCT (intron1) AhR [1760,1787], p53 [1783,1787]

AAAAAAAATTAGCCGGGCGTGGTGCTGG (intron6) AhR [12143,12170]

GAGGCTGAGGAAGGAGAATGGCGTGAAC (intron6) AhR [12195,12222]

We propose that DNA damage liberates transposable DNA elements that are normally repressed by p53 and other suppressor genes. The p53 repair/response also includes increased cooperation between p53 and AhR, which further influence transcription, mRNA splicing or post-translation events. Repeated damage, at multi-cellular scale, may proximally bias ILC's toward NK cells capable of specific non-self detection, through localized ligand, receptor relationships that trigger cytolysis and immune cascades. 

KS's are a retrospective view of transcripts ncDNA elements, ranked by cDNA that may reflect inherent bias that can be used to direct NK cell education. One way to accomplish minimal manipulation may be to leverage patient immunity by educating autologous NK cells with computationally selected tumor cells, identified by KS alignments to the index of past experiments that expanded and triggered a more desirable immune response. Customizable immune cascades, capable of managing disease or preventatively supporting a desired heterogeneity being the primary objective. 

Tolerating Your Non-self!

Immune cells get comfortable with cancer
Courtesy https://deepai.org

A hallmark of cancer, autoimmunity and disease is the aberrant transcription of typically silenced, repetitive genetic elements that mimic Pathogen-Associated Molecular Patterns (PAMP's) that bind Pattern Recognition Receptors (PPR's) triggering the innate immune system and inflammation. Unrestrained, this 'viral mimicry' activates a generally conserved mechanism that, under restraint, supports homeostasis. These repetitive viral DNA sequences normally act as a quality control over genomic dysregulation responding in ways that preferentially promote immune conditions for stability. If aberrantly unrestrained and the 'viral mimicry' is transcribed it may result in undesirable immune reactions that disrupt the homeostasis of cells.

Mitochondrial DNA (mtDNA) are one source of cytosolic double stranded RNA (dsRNA) that is commonly present in cells. Trp53 Mutant Embryonic Fibroblasts (MEF's) contain innate immune stimulating endogenous dsRNA, from mtDNA that mimic PAMP's. The immune response, via RIG-1 like PRR, leads to expression of type 1 interferon (IFN) and proinflammatory cytokine genes. Further, Natural Killer cells also produce a multitude of cytokines that can promote or dampen an immune response. Wild-type p53 suppresses viral repeats and contributes to innate immunity by enhancing IFN-dependent antiviral activity independent of its function as a proapoptotic and tumor suppressor gene. 

Post-translationally modified P53, located in the cytoplasm, enhances the permeability of the mitochondrial outer membrane thus stimulating apoptosis. However, treating Trp53 mutant MEF's with DNA demethylating agent caused a huge increase in the level of transcripts encoding short interspersed nuclear elements and other species of noncoding RNAs that generated a strong type 1 IFN response. This did not occur in p53 wild-type MEF's. Thus it appears that another function of p53 is to silence repeats that can accidentally induce an immune response.

This has several implications for how we understand self versus non-self discrimination. When pathogen-associated features were quantified, specific repeats in the genome not only display PAMP's capable of stimulating PRRs but, in some instances, have seemingly maintained such features under selection. For organisms with a high degree of epigenetic regulation and chromosomal organization immuno-stimulatory repeats release a danger signal, such as repeats released after p53 mutations. Here, immune stimulation may act as back-up for the failure of other p53 functions such as apoptosis or senescence due to mutation. This supports the hypothesis that specific repeats gained favor by maintaining non-self PAMPs to act as sensors for loss of heterochromatin as an epigenetic checkpoint of quality control that avoids genome instability generally. 

When P53 mutates it begins to fail its restraint of viral suppression, this enables a 'viral mimicry' and aberrant immune reactions. These may promote survival of cells that can leverage immunity, promote angiogenesis and heightened proliferation of cancers, or other diseases under modified conditions for non-self tolerance. 

ΔΨm and Immune Responses to Disease

Each cell contains hundreds to thousands of mitochondria, each with hundreds of electron transport chain complexes (ETC) that deliver ATP as the cells primary energy source and the central dogma of eukaryote existence. ETC function's, on the inner mitochondrial membrane, are sensitive to change in electric charge represented as mitochondrial polarization and mitochondrial membrane potential (ΔΨm). The large responsive surface area of the outer and inner membrane promotes remodeling and protein interactions that may lead to cellular diseases including cancer.

Tumor Necrosis Factor (TNF) causes mitochondria to relocate, to bind the nucleus and efficiently shuttle elements that enable fast DNA transcription and signaling that, under certain conditions, may suppress the pro inflammatory immune response. TNF signaling to mitochondrial PINK1 stabilizes ubiquitin chains that result in mitochondrial relocation and shuttling activated p65 that increases NF-κB transcription in the nucleus. This anti-apoptotic response resembles the feed forward activation loop in Pink1/Parkin-dependent mitophagy as an independent defense against accumulation of dysfunctional mitochondria, that under physiological conditions integrate their roles in innate immune signaling and stress. 

Enhanced activation of NF-κB by TNF, via mutant p53, concomitantly suppressed the pro-apoptotic effect of TNF leading to increased invasiveness of cancer cells. Accordingly mutant p53 may directly affect nuclear accumulation and retention of p65 upon cytokine exposure as mutant p53 overexpression and nuclear p65 staining in tumors strongly correlated.

Stresses elicited by aneuploid states in cells mediate interaction between Natural Killer (NK) cells. In highly aneuploid cancer cell lines NF-κB signaling is upregulated and activated promoting immune clearance by NK cells, but anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Rapid NF-κB signaling may be preferentially selected because it antagonizes p53, known to inhibit the growth of highly aneuploid cells. Significantly increased mitochondrial DNA in aneuploid cells may result from increased fission of mitochondria, similar to that found in extreme ploidy during Oocyte development. Perhaps supporting the reason in embryonic stem cells (ESC) apoptosis occurs independent of p53 and protein kinase Akt3, the regulator of ESC apoptosis, suppresses p53 for the survival and proliferation of these stem cells.

A comprehensive metabolic analysis identified mitochondrial polarization as a gatekeeper of NK cell priming, activation, and function. Mitochondrial fusion and OXPHOS promote long-term persistence and improve cytokine production by NK cells. Hypoxic Tumor Micro Environments (TME) sustained NK cell activation of mTOR-Drp1, which resulted in excessive mitochondrial fission and fragmentation. Inhibition of fragmentation improved mitochondrial metabolism, survival and the antitumor capacity of NK cells. 

Mitochondrial biogenesis also requires the initiation of Drp1-driven fission. Whereas, fissions from dysfunction are associated with diminished ΔΨm and Reactive Oxygen Species (ROS), which are unchanged in this biogenesis. Depletion of p53 exaggerates fragmentation, but does not affect ΔΨm and ROS levels. Instead, p53 depletion activates mTORC1/4EBP1 signaling that regulates MTFP1 protein expression to govern Drp1-mediated fission. Thus, increased fission upon p53 loss can stimulate biogenesis, but not accumulation of damaged mitochondria. This may explain how mitochondrial integrity, in context of p53 deficiency induced fragmentation, may suppress immune signaling.

Downregulating p53 expression or elevating the molecular signature of mitochondrial fission correlates with aggressive tumor phenotypes and poor prognosis in cancer patients. Upon p53 loss, exaggerated fragmentation stimulates the activation of ERK1/2 signaling resulting in epithelial-to-mesenchymal transition-like changes in cell morphology, accompanied by accelerated MMP9 expression and invasive cell migration. Notably, blocking the activation of mTORC1/MTFP1/Drp1/ERK1/2 axis completely abolishes the p53 deficiency-driven cellular morphological switch, MMP9 expression, and cancer cell dissemination. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

Vascular remodeling, in the uterus, during pregnancy is controlled by small populations of conventional Natural Killer cells that acidify the extracellular matrix (ECM) with a2V-ATPase that activates MMP9, degrades the ECM and releases pro-angiogenesis growth factors stored in the ECM. Hypoxic TME's that sustain excessive mitochondrial fission-fragmentation in NK cells would cause a2V-ATP activated MMP9 to similarly promote angiogenesis akin to Blastocyst implantation.  

ΔΨm as a measure of functional integrity maybe the flawed alert, a blind spot for the 'canary in the mine' of a cells' ADP-ATP pipeline. Likewise the status of TP53, from transcription through p53 isoform, may signal wide ranging affects of ΔΨm that incorporate fragmentation, accumulating damaged mitochondria, mitophagy, apoptosis, normal immune signaling and response through to mitochondrial biogenesis, differentiation, angiogenesis, reduced immune signaling and response. This modal duality aligns known functions of NK cells that under physiological conditions promote angiogenesis growth (as in Blastocyst implantation and placental vascularization) or NK's classic, cytolytic role in the innate immune response. 

The delicate balance in health and sensitivity of at least TP53 DNA is known to result in DNA to DNA and/or upstream RNA/protein interactions that influence mechanics of molecules and responses to ΔΨm variations. Here we have highlighted links between NK cell function relative to  mitochondrial polarization, ΔΨm and p53 relative to mitochondrial fission and immune signaling. 

Toward Customized Natural Killer Cells

An important role of Natural Killer (NK) cells is to eliminate other cells that extinguish or diminish expression of self-MHC class I molecules or Human Leukocyte Antigen (HLA), which commonly occurs as a result of viral infection or cellular transformation. This capacity arises because NK cells express stimulatory and inhibitory receptors that engage ligands on normal cells. The majority of inhibitory receptors belong to the Killer-cell immunoglobulin-like receptors (KIR) and CD94/NKG2A  families and are specific for MHC I molecules. When an NK cell encounters a normal cell, engagement of the inhibitory receptors conveys signals that counteract stimulatory signaling. Lysis occurs when inhibition is lost because the target cell lacks one or more self-MHC molecules or when target cells express high levels of stimulatory ligands that counter inhibition.

Mitochondrial DNA (MtDNA) embedded in the genomes of 66,000 humans was associated with adverse consequences including cancer. Overall tumor specific nuclear embedded MtDNA was more common on Chromosome (Chr)19, less common on Chr6 and tended to involve non-coding, repetitive elements or satellite repeats. 

The dimorphic relationship between genes on Chr6, encoding HLA and  Chr19, encoding KIRs  may elucidate how, why and when NK cells determine self restraint or attack cells infected by pathogens and disease. Chr19 has also been linked to blood pressure mechanics, immunity and checkpoints associated with P53. Cancer mutation burden is shaped by G4 DNA, cell cycle replication stress, DNA repair pathway and mitochondrial dysfunction. G4 DNA overrepresentation generally occurs in tumors with mutations in tumor suppressor gene's such as TP53. 

Whether KIR-HLA relationships are associated with p53 status of NK cells and of its target is unknown. However, it has been reported that cellular metabolism regulates a cells sensitivity to NK cells depending on its P53 status and that P53 pathway is coupled to NK cell maturation leaving open the possibility that a relationship exists. 

KIR and HLA genes are polymorphic and display significant variations, The independent segregation of these unlinked gene families produces extraordinary diversity in the number and type of KIR-HLA pairs inherited in individuals. Variation affects the KIR repertoire of NK cell clones, NK cell maturation, the capability to deliver signals, and consequently the NK cell response to human diseases.

One study suggests that functional interactions between KIR and HLA modify risks of basal cell carcinoma (BCC) and squamous cell carcinomas (SCC) and that KIR B haplotypes provide selective pressure for altered P53 in BCC tumors.

MtDNA and other insertions into nuclear DNA may have altered Chr19-Chr6 linkage relationships and KIR-HLA validity, affecting the integrity of NK missing-self surveillance. Therefore, P53 dependent metabolism and P53 coupled NK cell education may point to a required synchronicity, obtained through NK education, licensing KIR-HLA and other receptor-ligand combinations for a global NK symbiosis.

The altered landscape of cancer is often characterized by a heterogeneous mix of immunosuppressive metabolites, glucose and amino acid deprivation, hypoxia and acidity, which, in concert, prevent effective anti-tumor immunity, here NK therapies herald great potential.

NK cell co-culture with patient cells selected using precise P53 rankings for a distinct P53-coupled-NK cell education may realize a mature NK subset with P53-paired characteristics. Trojan therapy using autologous or combined allogeneic NK cells may promote licensing, through a broad synchronization including at least KIR-HLA. This ex-vivo approach may resist re-education in vivo and activate against P53-decoupled-KIR-HLA affected cells. The objective is an NK subset that, in vivo will initiate and progress a limited innate immune response and disrupt near-neighbor targets that will contribute to a broader immune response.  

Angiogenic Growth Factor Flood

A previous series, about p53 culminated with "Blastocyst Development - A Perfected Cancer Model" that focused on the parallels in angiogenesis, triggered by blastocyst implantation and progression of tumors beyond ~1mm. Now, a recent study has found that conventional Natural Killer cells (cNK) control vascular remodeling in the uterus during pregnancy by acidifying the extracellular matrix (ECM) with a2V-ATPase that activates MMP-9 that degrades the ECM. Ablation of a2V-ATPase decreases Bax and p53 expression in testis and leads to implantation failure in the female mouse. The degrading ECM releases bound pro-angiogenic growth factors that contribute to Uterine artery (UtA) remodeling characterized by the loss of vascular smooth muscle cells (VSMCs) and dilation of the vessels. Without cNK, the UtA never lose VSMCs and UtA resistance remains high often leading to implantation failure.

Its logical that a timely flood of angiogenic growth factors, previously stored in the ECM would provide instant availability, but whether this explains the maternal-embryonic immune paradox remains to be determined? In the immune paradox maternal NK cells invade and maternal blood vessels are remodeled just before the arrival of trophoblasts, the external cells of the blastocyst, that carry male antigens during formation of the fetal placenta. A sudden flood of angiogenic factors preceding invading trophoblasts could provide the perfect environment required for maternal arterial/vascular remodeling.

Lymphocytes in the uterine lining (decidua) are dominated by a unique decidual natural killer (dNK) cell population. The dNK cell surface phenotype CD56bright CD16− CD3− and macrophages CD14+ CD206+(dMac) support a model whereby dNK cells, capable of killing extra-villous cytotrophoblasts (CTB), are prevented from doing so by neighboring macrophages thus protecting the fetal cells from NK cell attack. Existing research has centered on the function of the abundant and diverse sets of dNK, but now that cNK cells have been identified to play a more significant role, our understanding of the remodeling are likely to change.

In CTB exogenous p53 is able to down-regulate MMP-9 promoter activity, but endogenous p53 is not able to regulate MMP-9 expression in first trimester CTB cells. Inactivation of p53 through mutation is the most common trait in cancer. By loosing its onco-suppressive activity, p53 becomes oncogenic in almost all malignant tumors (Soussi and Lozano, 2005). Although p53 is not mutated in the human placenta, it has become functionally incompetent. Understanding why and how p53 is functionally incompetent in CTB might well be the key to understanding trophoblast invasion.

Downregulation of EMMPRIN (BSG,CD147) by p53 leads to a decrease in the activity of MMP-9 and an inhibition of tumor cell invasion. Upregulation of EMMPRIN seen in many cancers can be attributed to, at least in part, to the dysfunction of p53 and thus provides new evidence for the roles of p53 in tumor development and progression. Epithelial derived MMP-9 exhibits a novel defensive role of tumor suppressor in colitis associated cancer by activating MMP9-Notch1-ARF-p53 axis. MMP-9 mediates Notch1 signaling via p53 to regulate apoptosis, cell cycle arrest, and inflammation. 

The inter-activity of p53, cNK and MMP-9 are complexed, but this novel research may lead to the mechanisms by which arterial remodeling occurs after release of angiogenic factors from ECM. If that shares characteristics of NK invasion into developing tumor micro environment's a new therapeutic approach may arise.